One of the biggest problems associated with the theory of evolutionism is that it irrationally supposes that the highly specific gene sequences in DNA can be put together through a process of chance and necessity, namely random mutation and natural selection. It is a deeply flawed argument that has no theoretical or empirical basis whatsoever and yet is widely accepted.

Let us consider this example: 7SK is a short non-coding RNA gene that is highly conserved in metazoan taxa.It is 332bp in length and, unlike protein-coding sequences, its nucleotide arrangement accurately reflects the arrangement of the RNA transcript. It is this specific order that confers its biochemical functionality.

Now, let us do some calculating for fun:

As there are 4 possible base pairs and 332 nucleotides in the sequence, it follows that there are 4^332 ways of arranging them: That is 7.65 * 10^199!. For those of you who don't like numbers, 10^12 is a trillion. And, yet, out of all these possible combinations, only a few (all variations on the one) are actually functional.

So, I would like to ask you: What "testable natural processes", as Calilasseia rants on about. could have managed to find such an improbable sequence? It is not like you could have built up the gene incrementally nucleotide by nucleotide. You would have had to have to started with something functional to begin with. Selection only selects what is reproductively advantageous.

I look forward to the non-explanations. However, a simple admission of guilt would do better.

Ah, the argument from big numbers. Again. Atheistoclast, what are the odds that you would have been born at the precise moment and place that you were? And yet, it happened. And happens many times a day, every day.

Colour me bored.

Probability doesn't matter if you have had billions of years to evolve.

Made of Stars wrote:Ah, the argument from big numbers. Again. Atheistoclast, what are the odds that you would have been born at the precise moment and place that you were? And yet, it happened. And happens many times a day, every day.

Colour me bored.

Big numbers decide the feasibility and viability of mechanism and processes. I am taking your response as an admission of ignorance.

Atheistoclast wrote:One of the biggest problems associated with the theory of evolutionism is that it irrationally supposes that the highly specific gene sequences in DNA can be put together through a process of chance and necessity, namely random mutation and natural selection. It is a deeply flawed argument that has no theoretical or empirical basis whatsoever and yet is widely accepted.

Not true. You're either lying through your teeth, or just plain ignorant of the facts. You decide.

BTW, 'evolutionism'? What sort of lexicographical wankery is that?

FreshwaterSeaCowHero wrote:Probability doesn't matter if you have had trillions of years to evolve.

But we didn't have trillions of years to evolve. And we would need more than just trillions, more like zillions.

Can someone point me to the theory of evolutionism... I can't seem to find it in any of the scientific literature.

Should I try the fiction section?

Atheistoclast wrote:

Made of Stars wrote:Ah, the argument from big numbers. Again. Atheistoclast, what are the odds that you would have been born at the precise moment and place that you were? And yet, it happened. And happens many times a day, every day.

Colour me bored.

Big numbers decide the feasibility and viability of mechanism and processes.

Are you familiar with 'arguments from incredulity'? Look them up.

Atheistoclast wrote:I am taking your response as an admission of ignorance.

Take it as an admission of disinterest in dealing with tired creationist canards. What next? A Texas sharpshooter fallacy? Do you run a cyclic roster on the lies and misinformation you post?

But for now,

Atheistoclast wrote:
As there are 4 possible base pairs and 332 nucleotides in the sequence, it follows that there are 4^332 ways of arranging them: That is 7.65 * 10^199!. For those of you who don't like numbers, 10^12 is a trillion. And, yet, out of all these possible combinations, only a few (all variations on the one) are actually functional.

Can we get a C?
Can we get an I?
Can we get a T?
Can we get an A?
Can we get a T?
Can we get an I?
Can we get an O?
Can we get a N?

Please Bob?

Atheistoclast wrote:One of the biggest problems associated with the theory of evolutionism is that it irrationally supposes that the highly specific gene sequences in DNA can be put together through a process of chance and necessity, namely random mutation and natural selection. It is a deeply flawed argument that has no theoretical or empirical basis whatsoever and yet is widely accepted.

Let us consider this example: 7SK is a short non-coding RNA gene that is highly conserved in metazoan taxa.It is 332bp in length and, unlike protein-coding sequences, its nucleotide arrangement accurately reflects the arrangement of the RNA transcript. It is this order that confers its biochemical functionality.

Now, let us do some calculating for fun:

As there are 4 possible base pairs and 332 nucleotides in the sequence, it follows that there are 4^332 ways of arranging them: That is 7.65 * 10^199!. For those of you who don't like numbers, 10^12 is a trillion. And, yet, out of all these possible combinations, only a few (all variations on the one) are actually functional.

So, I would like to ask you: What "testable natural processes", as Calilasseia rants on about. could have managed to find such an improbable sequence? It is not like you could have built up the gene incrementally nucleotide by nucleotide. You would have had to have to started with something functional to begin with. Selection only selects what is reproductively advantageous.

I look forward to the non-explanations. However, a simple admission of guilt would do better.

What would prevent the successive selection of insertions, substitutions and duplications from producing that 332 bp sequence? Are you claiming that there are no functional intermediates? Have you tested every single 7.65x10199 combination, in every single imaginable environment? No? So you're supplying an argument from ignorance then?

You're making the classical fallacy of assuming only the one extant sequence(or a few like it) are the ones which are functional. But these sequences are only functional because the environment they happen to be in, is one where the function they do is useful. Usually these sequences, if they aren't enzymes or ribozymes, serve as binding receptors of various sorts, thus their function(binding to something) is contingent on the surface properties of that to which they bind. To assert that just because changes in your particular transcript renders it nonfunctional, and therefore that it couldn't evolve gradually, is to assert that you know that which it bound to in the past didn't itself change from something else, and therefore didn't constitute a slope or hill for selection to climb and stay on.

Yes, yes I have just utterly annihilated the very basis of your argument, and the rest of this thread will now devolve into your wibbling lies. Have fun with it.

Atheistoclast wrote:

FreshwaterSeaCowHero wrote:Probability doesn't matter if you have had trillions of years to evolve.

But we didn't have trillions of years to evolve. And we would need more than just trillions, more like zillions.

The problem with that argument is that there isn't an annual evolution party. Evolution happens all of the time.
Evolution is much simpler than you think it is. For example. Let's say there is a family of tigers. One tiger is born with a defective gene and doesn't form frontal claws. Since frontal claws are used to take down prey, it can't feed itself. It starves to death, and it can't pass on that defective gene. Another tiger is born with longer frontal claws. This tiger can take down prey with ease. It mates and passes on that successful gene.
Now, this is proven because even in humans we see birth abnormalities (1 in 33, http://www.cdc.gov/ncbddd/birthdefects/data.html) that were not passed down by their parents.

So, I would like to ask you: What "testable natural processes", as Calilasseia rants on about. could have managed to find such an improbable sequence? It is not like you could have built up the gene incrementally nucleotide by nucleotide. You would have had to have to started with something functional to begin with. Selection only selects what is reproductively advantageous.

I wonder if certain sequence events happen at a chance greatly higher than purely by random.

Tyrannical wrote:

So, I would like to ask you: What "testable natural processes", as Calilasseia rants on about. could have managed to find such an improbable sequence? It is not like you could have built up the gene incrementally nucleotide by nucleotide. You would have had to have to started with something functional to begin with. Selection only selects what is reproductively advantageous.

I wonder if certain sequence events happen at a chance greatly higher than purely by random.

By what process?

Heh, turns out I was right, 7SK is a transcription factor that binds to another P-TEFb. Atheistoclast is blindly asserting that just because this 7SK is highly conserved(though, it turns out, not completely conserved), it couldn't have evolved through selection. Interestingly, there's also a hidden bait-into-defending-evolution-by-pure-selection twist to his argument that neglects the effects of genetic drift.

By what process?

Perhaps some undiscovered sub-atomic or chemical physical process. Many things in nature arrange themselves in a non-random process. It's well understood how and why crystals form a non-random lattice. Snowflakes though random, still form in distinct classes of arrangements. Maybe certain arrangements that are conductive to life as we know it happen more than chance, but with a scientific reason why.

Spearthrower wrote:Can someone point me to the theory of evolutionism... I can't seem to find it in any of the scientific literature.

Should I try the fiction section?

http://en.wikipedia.org/wiki/Evolutionism

Evolutionism tries to explain change in already functioning systems and structures. It doesn't explain their origination. This is relevant when considering the 7SK gene whose very short sequence is given below:

Code: Select all

GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGG
CTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCGCTCCATGTGCGTCCCTCCCGAAGCTGCGCGCTCGGT
CGAAGAGGACGACCATCCCCGATAGAGGAGGACCGGTCTTCGGTCAAGGGTATACGAGTAGCTGCGCTCC
CCTGCTAGAACCTCCAAACAAGCTCTCAAGGTCCATTTGTAGGAGAACGTAGGGTAGTCAAGCTTCCAAG
ACTCCAGACACATCCAAATGAGGCGCTGCATGTGGCAGTCTGCCTTTCTTTT

Atheistoclast, please address my post if you don't mind.I'm curious what you think.

Rumraket wrote:Heh, turns out I was right, 7SK is a transcription factor that binds to another P-TEFb. Atheistoclast is blindly asserting that just because this 7SK is highly conserved(though, it turns out, not completely conserved), it couldn't have evolved through selection. Interestingly, there's also a hidden bait-into-defending-evolution-by-pure-selection twist to his argument that neglects the effects of genetic drift.

7SK is a non-coding RNA transcript. If you know of any intermediates, let us know.

Genetic drift = random drift = pure chance.

Tyrannical wrote:

By what process?

Perhaps some undiscovered sub-atomic or chemical physical process. Many things in nature arrange themselves in a non-random process. It's well understood how and why crystals form a non-random lattice. Snowflakes though random, still form in distinct classes of arrangements. Maybe certain arrangements that are conductive to life as we know it happen more than chance, but with a scientific reason why.

I would not rule that possibility out. This would be similar to the notions of "molecular drive" and "self-organization". However, this implies that molecules are intelligent actors.

Atheistoclast wrote:

Spearthrower wrote:Can someone point me to the theory of evolutionism... I can't seem to find it in any of the scientific literature.

Should I try the fiction section?

http://en.wikipedia.org/wiki/Evolutionism

Evolutionism tries to explain change in already functioning systems and structures. It doesn't explain their origination. This is relevant when considering the 7SK gene whose sequence is given below:

Code: Select all

GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGG
CTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCGCTCCATGTGCGTCCCTCCCGAAGCTGCGCGCTCGGT
CGAAGAGGACGACCATCCCCGATAGAGGAGGACCGGTCTTCGGTCAAGGGTATACGAGTAGCTGCGCTCC
CCTGCTAGAACCTCCAAACAAGCTCTCAAGGTCCATTTGTAGGAGAACGTAGGGTAGTCAAGCTTCCAAG
ACTCCAGACACATCCAAATGAGGCGCTGCATGTGGCAGTCTGCCTTTCTTTT

Here's a list of variations of it: (In other words, there isn't "one true sequence")
http://www.bioinf.uni-leipzig.de/Publications/SUPPLEMENTS/07-021/7SK-GENBANK.fa

>Gdom_7SK Gallus domesticus
GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCCAG
GGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTC
ACCGCTCCATGTGCGTCCCTCCCGAAGCTGCGCGCTCGGTCGAAGAGGAC
GACCTTCCCCGATAGAGACGGTACCGTTCATCGGTCAAGGGTATACGGTA
GCTGCGCTCCCCTGCTAGAACCTCCAAACAAGCTCAAGGTCCATTTGTAG
GAGAACGTAGGGTAGTCAAGCTTCCAAGACTGCAGACACATCCAAGTGAG
GCACTGCATGTGGCAGTCTGCCTTTCTTT

>Xlae_7SK Xenopus laevis
GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCTAG
GGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTC
ACCGCTCCATGTGCGTCCCTCCCGAAGCTGTGCGCTCGGTCGAAGAGGAT
GGCTGTCCCCGATAGAGAAGCACCGAACTCCGTTCAAGAGTATACGAGTA
GCTGCGCTCCCCTGCTAGAACCTCCAAACAAGCTTCAAGTACGTAGGGTA
GTCAAGCTCCAAATCTTCAAGCACATCCAAGTGTGGCGCTGCACGTGGCA
GTCTGCCTTCCTTTTT

>Gmor_7SK Gadus morrhua
GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCTAG
GGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTC
CGTTCCATGTGTGTCCCTCCCGAAGCCCCGCGCTCGGTGCTAGTGGACGT
ATCCCGGCGGACGAGCATCGTTGGTATACCAGTAGCTGCTCCCCTGCTAG
AACCTCCAAACAAGCTCAAGGCCCATTTGTAGGAGAAACGTAGGGAAGTC
AAGCTCCAAGACTTCAGACACATCCAAATGAGGCGCTGCACGTGGCAGTC
TGCCGTAATTTT

>Mast_7SK Mustelus asterias
GGGTGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCTAG
GGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCCTTCCCTCAC
AGCTCCATGTGCGTCCCTCCCGAAGCTCAGCGCTCGGTCGCAGAGGATGA
CCCCCTAGAAGAGGACCGCTCCGCCGGTCTAGGGTATATGACGTAGCTAC
ACTCCCCTGCTAGGCTAAACCTCCAAGACCATTTGTAGGATGACGTAGGG
AAGTCAAGCTCCAAGACTTCAGACACATCCAAGTCAGGCACTGCACGTGG
CAGTCTGCCGTTCTTT

>Lflu_7SK Lampetra fluviatilis [Gursoy]
GGATGTGCCGGGCGATTTGGCAGCGACACCTTCTCACCATCCATTGATCG
CTAGGGCAAGTTCGGCTGATCTGGCTGCATAGATCGGTGTCCCCTCATCG
GCGCTCATCCGTGTTCGTCCCTCCCGATGCTCTGCGCTCGGTGGCAGCGG
ACTCCGACCCCCGAGGGACCGGCAACGGCTTCTTCGTCGAGGTCGCGGGT
TTAGGCGTAGCGACGGCTCCCTGCTAGACCAAACTCCACGGGCGAGGCGA
GTAGGCGAGCTGGAACTCCGACTACAGCATCCACATCCAGATCGGCACTG
CACGTGGCAGTCTGCCTGTTTT

>Mglu_7SK Myxine glutinosa
GGATGTGCAGGTGGAATTGGCCGCGACTCCCATCACTCCCATTGATCGCT
AGCGCTAGGATCGGCTGATCTGGTTGGTTAGATGGGGCGTCCCCCGTTCC
CCGCACGGATCCGCGTCCGGCCTCGCCGATGCCCCGCGCTCGGATCGACG
GCCGAGAGGCTCACCGCACGCACCACGCTCACGGCTACGGCGCACGGGTT
TAACCACGGAGCTGCGAGTACCCACTTAGACCAAACCCCGGAGACGGCGA
CGGCGATAAGAGGGAAGCACGCTCTGCACCATATGTTGCACATCCAACAC
GGCGCTGCACGTGGCAGTTTGCCTTGTTT

>Blan_7SK Branchiostoma lanceolatum
GGTTTGGCATCACCCCGTCCATAGATCGCCCCCGTAGTGTGTTTCGGCCG
ATCTGGCTGGTTCCGTGTTGCCTCCGCCACATCCGCATCTCTTCCACCGG
CTCTCCCGACGCCTCGCGCTCGGTCGAGAGTCTACCTCCTCCCCGAGTCA
ACCCCCTGTGATTGCCGAAAGGTTGGGTGAAAAGCGTAGCTGCAGCCCCT
GATGTTCTCCACTGCTAGGGTCAGAGAGCGTCGTGTCGAGCGCAGCAAAG
CCAAGACGCCACACACATCCAATACGGCGCTGCCACGCGGGCAGCCTGCC
ATTT

>Hpom_7SK Helix pomatia
GAGCGTGTGTCAGGAGACACGTCTGACATTGATCGCTATGATCTTATACG
GCTTGATCTGTCTAGATTGGTTGTTTCCACCACACCATTCCGATAGTTGA
GCTCCCGCTGCACCCCCGGGGACGCACGGTCGAGCTCTGTTCAAAATTGC
TGGTCGTAGAGTTTGCATGGCTCGGCGGCCAATGGGGTTATTTCTGTTAG
GGCTTCTCTCTATTTCCGCGTAACGGGGAAGTTCGTTTTCAGAAACCATT
TGAATTTATGTCGCTCCATTGGAGGCATTACACGTGGTAATCTGCCTTTC
TTT

In fact, a quick BLAST search will reveal that it can differ by as much as 17% in Homo Sapiens alone.