CharlieM and his defense of Dembski

Unsurprising creationist gibberish

Incl. intelligent design, belief in divine creation

Moderators: Calilasseia, DarthHelmet86, Onyx8

CharlieM and his defense of Dembski

#1  Postby Rumraket » Aug 12, 2014 10:05 am

I remember a thread a while back, which I'll go dig up later, in which CharlieM mentioned** that he thinks some one like Richard Dawkins is a lot more closed-minded and biased, than some one like Bill Dembski. What I took to be insinuated at the time was that CharlieM thinks some one like Bill Dembski is a lot more rational and reasonable in his consideration of the evidence, in comparison to Richard Dawkins. That nasty, closed-minded, strident materialist.

We of course argued about that and dug up a few quotes of Dembski's about his beliefs, but this one has to take the cake:
From here:
Rexsalad
Posted August 10, 2014 at 11:58 am | Permalink
I had the opportunity to once ask Dembski, who was surrounded by admirers after a Tulane sponsored ID/evolution debate, that should his famous flagellum example or any other “evidence” he believes supports ID (biological, cosmological) be refuted to his satisfaction would he ever concede he was wrong, no design necessary. I was expecting a wiggly answer. What I got was an unapologetic “No”. This minutes after and not ten feet from where he had spent an hour and a half claiming his hypothesis was purely scientific and not religious. Color me gobsmacked.


I'm not aware of Richard Dawkins ever saying that nothing could change his mind about design. Can we get a comment from Charlie?

**ETA - CharlieM @ Why are creationists called frequently liars at this forum ?
Half-Life 3 - I want to believe
User avatar
Rumraket
THREAD STARTER
 
Posts: 13215
Age: 40

Print view this post

Ads by Google


Re: CharlieM and his defense of Dembski

#2  Postby Animavore » Aug 12, 2014 10:38 am

On the movie Expelled Dawkins actually suggested a couple of ways our DNA might be designed and how we might find it.
A most evolved electron.
User avatar
Animavore
 
Name: The Scribbler
Posts: 44752
Age: 42
Male

Ireland (ie)
Print view this post

Re: CharlieM and his defense of Dembski

#3  Postby DavidMcC » Aug 12, 2014 12:33 pm

Animavore wrote:On the movie Expelled Dawkins actually suggested a couple of ways our DNA might be designed and how we might find it.

No doubt the film makers wanted to use any scrap of hope for ID that they could find in Dawkins' words.
May The Voice be with you!
DavidMcC
 
Name: David McCulloch
Posts: 14913
Age: 67
Male

Country: United Kigdom
United Kingdom (uk)
Print view this post

Re: CharlieM and his defense of Dembski

#4  Postby Animavore » Aug 12, 2014 2:51 pm

DavidMcC wrote:
Animavore wrote:On the movie Expelled Dawkins actually suggested a couple of ways our DNA might be designed and how we might find it.

No doubt the film makers wanted to use any scrap of hope for ID that they could find in Dawkins' words.

That's exactly what they did. Ben what's-his-face voiceover cuts in and says something like, "DId Richard Dawkins just say intelligent design was possible?" or something like that.
A most evolved electron.
User avatar
Animavore
 
Name: The Scribbler
Posts: 44752
Age: 42
Male

Ireland (ie)
Print view this post

Re: CharlieM and his defense of Dembski

#5  Postby Rumraket » Aug 12, 2014 3:00 pm

I also have to note that if I thought I was talking to a truly rational and reasonable person, if I asked them the question quoted in the op I wouldn't be expecting a "wiggly" answer, but an unambigous "Yes - of course!".

This is the exact same thing we saw with Billy Nye vs Ken Ham. What would change your mind?
Bill Nye: Evidence.
Ken Ham: Nothing ever could.

It just goes to show that when the accusation of dogmatism and faith is leveled against "evolutionists", it's actually projection.
Half-Life 3 - I want to believe
User avatar
Rumraket
THREAD STARTER
 
Posts: 13215
Age: 40

Print view this post

Re: CharlieM and his defense of Dembski

#6  Postby DavidMcC » Aug 12, 2014 3:02 pm

Animavore wrote:
DavidMcC wrote:
Animavore wrote:On the movie Expelled Dawkins actually suggested a couple of ways our DNA might be designed and how we might find it.

No doubt the film makers wanted to use any scrap of hope for ID that they could find in Dawkins' words.

That's exactly what they did. Ben what's-his-face voiceover cuts in and says something like, "DId Richard Dawkins just say intelligent design was possible?" or something like that.

I thought as much! Thanks for confirming it, Animavore. :thumbup:
May The Voice be with you!
DavidMcC
 
Name: David McCulloch
Posts: 14913
Age: 67
Male

Country: United Kigdom
United Kingdom (uk)
Print view this post

Re: CharlieM and his defense of Dembski

#7  Postby Dolorian » Aug 12, 2014 3:27 pm

Animavore wrote:That's exactly what they did. Ben what's-his-face voiceover cuts in and says something like, "DId Richard Dawkins just say intelligent design was possible?" or something like that.


That's very much what the creationists/IDers always do. Every time they see a scientist admit the posibility of the contrary with respect to a certain theory, they go "AHA! They admit it! They don't know absolutely that their current theory is true!" (as if science is ever based around the notion of absolute certainty). They then use this to try and place their own supernatural ideas on the same footing as established scientific theories such as evolution.

Seems rather similar to how they think that because one cannot prove that God does not exists that this somehow lends credibility to the claim that he actually does.
User avatar
Dolorian
 
Posts: 200
Age: 40
Male

Print view this post

Ads by Google


Re: CharlieM and his defense of Dembski

#8  Postby bert » Aug 12, 2014 3:53 pm

Yes, it could be designed. And it could be that a pink unicorn did that. We're open. But of course, to change our mind from the null hypothesis, evidence has to be brought to the table.

Dembski believing it very strongly is not the evidence we're convinced by.

Bert
Who saw (part of) a movie on islam that didn't make him very happy:
http://www.atheistrepublic.com/document ... gion-peace
It is a movie explaining why some people feel even stronger about their belief and how it should be spread.
Promote rational thought on religion by telling other people to download this free booklet. Read it yourself and you may well learn new arguments and a new approach to debunk religion
bert
 
Posts: 517
Male

Netherlands (nl)
Print view this post

Re: CharlieM and his defense of Dembski

#9  Postby CharlieM » Aug 12, 2014 6:50 pm

Rumraket wrote:I remember a thread a while back, which I'll go dig up later, in which CharlieM mentioned that he thinks some one like Richard Dawkins is a lot more closed-minded and biased, than some one like Bill Dembski. What I took to be insinuated at the time was that CharlieM thinks some one like Bill Dembski is a lot more rational and reasonable in his consideration of the evidence, in comparison to Richard Dawkins. That nasty, closed-minded, strident materialist.

We of course argued about that and dug up a few quotes of Dembski's about his beliefs, but this one has to take the cake:
From here:
Rexsalad
Posted August 10, 2014 at 11:58 am | Permalink
I had the opportunity to once ask Dembski, who was surrounded by admirers after a Tulane sponsored ID/evolution debate, that should his famous flagellum example or any other “evidence” he believes supports ID (biological, cosmological) be refuted to his satisfaction would he ever concede he was wrong, no design necessary. I was expecting a wiggly answer. What I got was an unapologetic “No”. This minutes after and not ten feet from where he had spent an hour and a half claiming his hypothesis was purely scientific and not religious. Color me gobsmacked.


I'm not aware of Richard Dawkins ever saying that nothing could change his mind about design. Can we get a comment from Charlie?


I will have very little internet access for the rest of this week so I won't be able to say much 'till then. Maybe you will have found the relevant conversation by then. As for your quote from an ID critic relating a conversation between him/herself and Dembski, without more details I don't see how this story can be treated as anything but idle gossip. Do you have any more on this story (I don't have time to search for anything on it at the moment)?

Maybe by the time I get back Dembski's upcoming talk will be available on the 'net and we will have more to talk about.
CharlieM
 
Name: Charlie Morrison
Posts: 1044

Country: UK
Scotland (ss)
Print view this post

Re: CharlieM and his defense of Dembski

#10  Postby Weaver » Aug 12, 2014 7:28 pm

Who cares? Dembski hasn't been shown to be right yet - what he says is of no matter.
Image
Retired AiF

Cogito, Ergo Armatus Sum.
User avatar
Weaver
RS Donator
 
Posts: 20125
Age: 52
Male

Country: USA
United States (us)
Print view this post

Re: CharlieM and his defense of Dembski

#11  Postby Bribase » Aug 12, 2014 11:54 pm

Animavore wrote:
DavidMcC wrote:
Animavore wrote:On the movie Expelled Dawkins actually suggested a couple of ways our DNA might be designed and how we might find it.

No doubt the film makers wanted to use any scrap of hope for ID that they could find in Dawkins' words.

That's exactly what they did. Ben what's-his-face voiceover cuts in and says something like, "DId Richard Dawkins just say intelligent design was possible?" or something like that.


I think Dawkins was talking about directed panspermia. Of course it's tough to tell for sure considering quite how edited the interview was.

Timestamped linky:

https://www.youtube.com/watch?v=t0B_v1_YCa8#t=3m14

For the record I think it's fair that CharlieM need not respond to insubstantiated anecdotes like the one cited. Then again, it's on record that his students are directed to post a minimum of 3000 words promoting intelligent design on web forums that are "hostile" to it. More the actions of someone forming an army of apologists than that of someone weighing up the evidence.
User avatar
Bribase
 
Posts: 2671
Age: 39
Male

Print view this post

Re: CharlieM and his defense of Dembski

#12  Postby Calilasseia » Aug 13, 2014 3:42 am

Ah yes, the infamous Dembski PointsTM. Which as you've pointed out, are not the product of serious academic activity.

But then, I've known for some time that Dembski isn't interested in evidence, he's interested in achieving hegemony for his favourite mythology. Why else would he write the following, in a book with the title Intelligent Design: The Bridge Between Science And Theology, a title that alone betrays his ideological presuppositions on a grand scale:

William Dembski wrote:My thesis is that the disciplines find their completion in Christ and cannot be properly understood apart from Christ ... The point to understand here is that Christ is never an addendum to a scientific theory but always the completion.


William Dembski wrote:Not only does intelligent design rid us of this ideology, which suffocates the human spirit, but, in my personal experience, I've found that it opens the path for people to come to Christ. Indeed, once materialism is no longer an option, Christianity again becomes an option. True, there are then also other options. But Christianity is more than able to hold its own once it is seen as a live option. The problem with materialism is that it rules out Christianity so completely that it is not even a live option. Thus, in its relation to Christianity, intelligent design should be viewed as a ground-clearing operation that gets rid of the intellectual rubbish that for generations has kept Christianity from receiving serious consideration


William Dembski wrote:I think at a fundamental level, in terms of what drives me in this is that I think God's glory is being robbed by these naturalistic approaches to biological evolution, creation, the origin of the world, the origin of biological complexity and diversity. When you are attributing the wonders of nature to these mindless material mechanisms, God's glory is getting robbed. [...] And so there is a cultural war here. Ultimately I want to see God get the credit for what he’s done — and he's not getting it.


Later on, after he penned that tedious screed, he attended a religious panel discussion arranged by creationists, with the typically telling title of Defeating Darwinism In Our Culture (how they love their "Darwinism" meme, and the duplicitous misrepresentation of valid, evidence-based science as some sort of "doctrine"), where he uttered the following drivel:

William Dembski wrote:The job of apologetics is to clear the ground, to clear obstacles that prevent people from coming to the knowledge of Christ. ... And if there's anything that I think has blocked the growth of Christ as the free reign of the Spirit and people accepting the Scripture and Jesus Christ, it is the Darwinian naturalistic view.... It's important that we understand the world. God has created it; Jesus is incarnate in the world.


Then he uttered the following, when interviewed about his forthcoming appointment to an "academic" position at Southern Baptist Theological Seminary (surely this appointment alone betrays his real agenda?):

William Dembski wrote:This is really an opportunity to mobilize a new generation of scholars and pastors not just to equip the saints but also to engage the culture and reclaim it for Christ. That's really what is driving me.


Oh, and then we have this laughably failed prediction, dating from 2004, and originally published here:

William Dembski wrote:In the next five years, molecular Darwinism—the idea that Darwinian processes can produce complex molecular structures at the subcellular level—will be dead. When that happens, evolutionary biology will experience a crisis of confidence because evolutionary biology hinges on the evolution of the right molecules. I therefore foresee a Taliban-style collapse of Darwinism in the next ten years. Intelligent design will of course profit greatly from this.


Here we are, in 2014, and far from being "dead", molecular evolution has gone from strength to strength, and the number of papers being published in the fields runs to several thousand per year. But I digress. Moving on, we have the following infamous utterance, which he presented as the "vise" strategy (here in the UK, we refer to the machine shop tool in question as a "vice", just to clarify matters), dating from May 2005:

William Dembski wrote:Thus, in a crucial way, the Kansas hearings repeat the pattern set by the Scopes Trial, which has been repeated many times since, namely, evolutionists escaped critical scrutiny by not having to undergo cross-examination. In this case, they accomplished the feat by boycotting the hearings. I therefore await the day when the hearings are not voluntary but involve subpoenas that compel evolutionists to be deposed and interrogated at length on their views.


The fun part being of course, that when he was given the opportunity to act as a champion for ID in the Dover Trial in September 2005, he chickened out, along with several other Duplicity Institute "fellows", who presumably took the advice of Philip Johnson (the serious lawyer in the organisation) that the vacuity of their case would be made so embarrassingly public at that trial once the scientific big guns turned up, that it was best to leave Michael Behe to carry the can and flush his reputation down the toilet on their behalf. Of course, what Dembski really wants, as that above quote reveals, is the erection of a creationist Inquisition against anyone who does not conform to creationist doctrine and orthodoxy.

Even more telling is this quote he posted over at Uncommon Descent (most observers more properly think of its as "Undecent Common"), where he delivered the following blatantly ideology-driven view of evidence:

William Dembski wrote:The mountains of evidence are already there. The problem is that evidence is itself inherently hermeneutical, influenced by cognitive predispositions to interpret certain types of data as supporting/confirming certain types of conclusions. If one wears materialistic blinders, there can be no evidence for ID hence the constant refrain by people like Barbara Forrest and Eugenie Scott that there is no evidence for ID. There is none for them because they have shut their eyes to it.


How often have we seen creationists misrepresent the proper process of letting data shape ideas as purportedly constituting an "ideology"? It's a tiresomely predictable creationist trope, trotted out whenever real world data doesn't conform to their doctrine and ideology.

In the light of all of this, the idea that it's Dawkins rather than Dembski who is the stubborn, closed-minded ideologue, is frankly laughable.
Signature temporarily on hold until I can find a reliable image host ...
User avatar
Calilasseia
RS Donator
 
Posts: 22091
Age: 59
Male

Country: England
United Kingdom (uk)
Print view this post

Re: CharlieM and his defense of Dembski

#13  Postby Rumraket » Aug 14, 2014 10:36 am

William Dembski wrote:The mountains of evidence are already there. The problem is that evidence is itself inherently hermeneutical, influenced by cognitive predispositions to interpret certain types of data as supporting/confirming certain types of conclusions. If one wears materialistic blinders, there can be no evidence for ID hence the constant refrain by people like Barbara Forrest and Eugenie Scott that there is no evidence for ID. There is none for them because they have shut their eyes to it.

This one is simply brilliant, the exact same shit could be thrown right back at Dembski. The projection is reeking off it:

The mountains of evidence are already there. The problem is that evidence is itself inherently hermeneutical, influenced by cognitive predispositions to interpret certain types of data as supporting/confirming certain types of conclusions. If one wears creationist blinders, there can be no evidence for evolution hence the constant refrain by people like Bill Dembski and Stephen Meyer that there is no evidence for evolution. There is none for them because they have shut their eyes to it.
Half-Life 3 - I want to believe
User avatar
Rumraket
THREAD STARTER
 
Posts: 13215
Age: 40

Print view this post

Re: CharlieM and his defense of Dembski

#14  Postby Rumraket » Aug 14, 2014 10:50 am

CharlieM wrote:
Rumraket wrote:I remember a thread a while back, which I'll go dig up later, in which CharlieM mentioned that he thinks some one like Richard Dawkins is a lot more closed-minded and biased, than some one like Bill Dembski. What I took to be insinuated at the time was that CharlieM thinks some one like Bill Dembski is a lot more rational and reasonable in his consideration of the evidence, in comparison to Richard Dawkins. That nasty, closed-minded, strident materialist.

We of course argued about that and dug up a few quotes of Dembski's about his beliefs, but this one has to take the cake:
From here:
Rexsalad
Posted August 10, 2014 at 11:58 am | Permalink
I had the opportunity to once ask Dembski, who was surrounded by admirers after a Tulane sponsored ID/evolution debate, that should his famous flagellum example or any other “evidence” he believes supports ID (biological, cosmological) be refuted to his satisfaction would he ever concede he was wrong, no design necessary. I was expecting a wiggly answer. What I got was an unapologetic “No”. This minutes after and not ten feet from where he had spent an hour and a half claiming his hypothesis was purely scientific and not religious. Color me gobsmacked.


I'm not aware of Richard Dawkins ever saying that nothing could change his mind about design. Can we get a comment from Charlie?


I will have very little internet access for the rest of this week so I won't be able to say much 'till then. Maybe you will have found the relevant conversation by then. As for your quote from an ID critic relating a conversation between him/herself and Dembski, without more details I don't see how this story can be treated as anything but idle gossip.

For some really strange reason I have a hard time imagining you'd show the same restraint if the roles had been inverted.

Do you have any more on this story (I don't have time to search for anything on it at the moment)?

What else is there to say? Dembski is engaging in classic creationist tripe:
creationism.gif
creationism.gif (227.59 KiB) Viewed 2028 times


He has done everything to erode being given the benefit of doubt.

CharlieM wrote:Maybe by the time I get back Dembski's upcoming talk will be available on the 'net and we will have more to talk about.

His talk is irrelevant, we already know what he was talking about. His repeatedly refuted NFL theorem. If you want to discuss it because you're infatuated with his shit, go take a look here first:
http://theskepticalzone.com/wp/?s=EleP%28T%7CH%29ant&submit=Search
and
http://theskepticalzone.com/wp/?s=NFL+theorem&submit=Search

Read the threads that come up in those searches, which all deal with Dembski's attempt to establish a method of ruling out all relevant/naturalistic chance hypotheses. Turns out he can't. Dembski's caricature of evolution is a coinflip. Where does natural selection factor into coin flips? That's right, nowhere.

That's it, we're done. His "theorem" is shit.

Stop suckling Dembski milk, it's not good for you. It has anti-nutrients, it destroys brain-cells.
Half-Life 3 - I want to believe
User avatar
Rumraket
THREAD STARTER
 
Posts: 13215
Age: 40

Print view this post

Re: CharlieM and his defense of Dembski

#15  Postby Animavore » Aug 14, 2014 10:52 am

Rumraket wrote:
William Dembski wrote:The mountains of evidence are already there. The problem is that evidence is itself inherently hermeneutical, influenced by cognitive predispositions to interpret certain types of data as supporting/confirming certain types of conclusions. If one wears materialistic blinders, there can be no evidence for ID hence the constant refrain by people like Barbara Forrest and Eugenie Scott that there is no evidence for ID. There is none for them because they have shut their eyes to it.

This one is simply brilliant, the exact same shit could be thrown right back at Dembski. The projection is reeking off it:

The mountains of evidence are already there. The problem is that evidence is itself inherently hermeneutical, influenced by cognitive predispositions to interpret certain types of data as supporting/confirming certain types of conclusions. If one wears creationist blinders, there can be no evidence for evolution hence the constant refrain by people like Bill Dembski and Stephen Meyer that there is no evidence for evolution. There is none for them because they have shut their eyes to it.


The difference is that when it's said in the opposite direction it is said without lying.
There are two lies in Dembski's quote above.

If one wears materialistic blinders...


Acceptance of evolution (or rejection of ID) does not require materialism.

...there can be no evidence for ID.


Of course there can. There's evidence for intelligent design everywhere. We're surrounded by it. We know what designed things look like and the type of things which point toward their construction. This includes in things like DNA where we should see, if ID is correct, evidence of tampering and fixing.

I'm sure Dembski is feeling a certain burning sensation in his nether regions.
A most evolved electron.
User avatar
Animavore
 
Name: The Scribbler
Posts: 44752
Age: 42
Male

Ireland (ie)
Print view this post

Ads by Google


Re: CharlieM and his defense of Dembski

#16  Postby CharlieM » Aug 20, 2014 2:58 pm

Weaver wrote:Who cares? Dembski hasn't been shown to be right yet - what he says is of no matter.


So why bother getting involved in this thread? Can you give specific examples where you think he is wrong?

Here is a video of Dembski v Shermer. If you can be bothered to watch it, tell me where you think he is wrong.

Are both he and Shermer wrong when, around the 8 minute mark, they say:

Shermer - I don't think ID, the intelligent designer can be God in the traditiona sense.
Dembski - Well there's a lot actually that I agree with, with Michael, what he said, that the designer of intelligent design is not going to be the traditional God, that's exactly right, in fact that's why a lot of the creationists are now distancing themselves from intelligent design.


CharlieM
 
Name: Charlie Morrison
Posts: 1044

Country: UK
Scotland (ss)
Print view this post

Re: CharlieM and his defense of Dembski

#17  Postby Shrunk » Aug 20, 2014 3:24 pm

It may not be that Dembski is close minded. He could just have no choice but to lie if he wants to keep his current job. He was in a similar situation where he wrote a book which suggested that the story of Noah's flood might not be literally true. After the "school" for which he worked threatened to fire him, he recanted and affirmed his belief in Biblical inerrantist Young Earth Creationism.

http://pandasthumb.org/archives/2010/10 ... oming.html

'Cuz, you know, Dembski is all about the truth and intellectual honesty and all that. :lol:
Last edited by Shrunk on Aug 20, 2014 3:37 pm, edited 1 time in total.
"A community is infinitely more brutalised by the habitual employment of punishment than it is by the occasional occurrence of crime." -Oscar Wilde
User avatar
Shrunk
 
Posts: 26170
Age: 56
Male

Country: Canada
Canada (ca)
Print view this post

Re: CharlieM and his defense of Dembski

#18  Postby Shrunk » Aug 20, 2014 3:25 pm

CharlieM wrote:
Weaver wrote:Who cares? Dembski hasn't been shown to be right yet - what he says is of no matter.


So why bother getting involved in this thread? Can you give specific examples where you think he is wrong?


:rofl: Where does one begin?
"A community is infinitely more brutalised by the habitual employment of punishment than it is by the occasional occurrence of crime." -Oscar Wilde
User avatar
Shrunk
 
Posts: 26170
Age: 56
Male

Country: Canada
Canada (ca)
Print view this post

Re: CharlieM and his defense of Dembski

#19  Postby Rumraket » Aug 20, 2014 4:05 pm

CharlieM wrote:
Weaver wrote:Who cares? Dembski hasn't been shown to be right yet - what he says is of no matter.


So why bother getting involved in this thread? Can you give specific examples where you think he is wrong?

Yeah. His CSI term, "complex specified information" is total bullshit.

Please calculate the CSI for this stretch of DNA:

TAGGTGTGATCTGCCGTAGCAAGGGCAAGACTGGTCTTACTGACGTGGTCCGGC

Then tell me whether it was designed or not.

Good luck!
Half-Life 3 - I want to believe
User avatar
Rumraket
THREAD STARTER
 
Posts: 13215
Age: 40

Print view this post

Re: CharlieM and his defense of Dembski

#20  Postby Shrunk » Aug 20, 2014 4:21 pm

Rumraket wrote:
CharlieM wrote:
Weaver wrote:Who cares? Dembski hasn't been shown to be right yet - what he says is of no matter.


So why bother getting involved in this thread? Can you give specific examples where you think he is wrong?

Yeah. His CSI term, "complex specified information" is total bullshit.

Please calculate the CSI for this stretch of DNA:

TAGGTGTGATCTGCCGTAGCAAGGGCAAGACTGGTCTTACTGACGTGGTCCGGC

Then tell me whether it was designed or not.

Good luck!


I'm sure I've posted this before, but it's one of the best expose's on CSI, which reveals that the IDiot creationists, themselves, don't even know what it is, or how to calculate it:

http://www.softwarematters.org/mathgrrl.html
"A community is infinitely more brutalised by the habitual employment of punishment than it is by the occasional occurrence of crime." -Oscar Wilde
User avatar
Shrunk
 
Posts: 26170
Age: 56
Male

Country: Canada
Canada (ca)
Print view this post

Next

Return to Creationism

Who is online

Users viewing this topic: No registered users and 1 guest