Bob@RealScienceRadio wrote:As I go through the posts in this thread, there are so many that bring up such big and important issues, as with byofrcs.
byofrcs wrote:The problem with Dawkins' use... and the creationists use of design is that no one can tell the difference between a design that has been evolved and a design that has been created manually. ... they are unable to show how you can tell the difference.
Hello byofrcs! Both sides have long offered their methods of demarcation. Perhaps like you, I've been reading mainstream evolutionary work for decades, since the 1970s for me, and reading Dawkins specifically along with creationist writings since the 80s, and the "old-earth" ID movement since the 90s. The Darwinist camp offers a philosophical, and the ID camp provides a mathematical, method of demarcation.
For decades Dawkins has joined in with anti-creationist long-time president of the Nat'l Ctr for Sci Education
Do you have an issue writing
National Center for Science Education?
Bob@RealScienceRadio wrote:, Eugenie Scott, and the wider Darwin community, by making a philosophical argument against design.
Actually the problem with design is the absolute lack of any science, at all. It's all posturing and fancy sounding techno-babble hard for laymen to pick apart.
Bob@RealScienceRadio wrote:Essentially, their claim is: An all-wise designer *would not* make certain design decisions, like our retina wiring, or pseudogenes (aka junk DNA).
No, the claim isn't that a designer would not make such things. The problem is that the ID position is so broad, all-encompassing and totally ad-hoc, it is impossible to observationally test it. It makes zero predictions. All the theorists ever do is sit back, wait for "Darwinist" scientists to find something new and interesting and then declare after the fact, that "this is what the designer wanted" all along.
Bob@RealScienceRadio wrote:For their part, the ID movement has provided a mathematical definition for discerning intentional design, as in their little book by Dembski & Witt, Intelligent Design Uncensored (after that brief read I interviewed one of the authors).
Actually they have not. Low level statistician and religious apologist Bill Dembski, has created a method he CLAIMS discerns design, when in actual fact it does no such thing.
Nobody, including Dembski, can actually use his purported design detection system to detect any actual design.
If you think it can, then tell me if this piece of RNA was designed:
GUAGAUCGUCCAACGAUAUCACGGGGG
Show how you determine your result.
Bob@RealScienceRadio wrote:Notice that Dawkins, Scott, et al., do not provide a scientific rebuttal to design but they offer a philosophical (theological) argument: That God wouldn't have done it that way. No good designer would fill his design with junk and wire things backwards.
If on the other hand a designer can just decide to make anything any way it wants, how could we ever know whether it was designed? If a designer intentionally designed something to look like it evolved, would Dembski's method detect that? Show me.
Bob@RealScienceRadio wrote:Much of the primary evidence offered up as conclusively showing bad design (badly wired retina, useless dna, etc.) has already turned out to be an argument from ignorance.
No it hasn't.
Bob@RealScienceRadio wrote:For researchers have found more and more important functions in the alleged poor design.
I'm going to go out on a limp and predict you have absolutely zero clue about the case for junk DNA.
Tell me, what does the term "pervasive transcription" refer to? Use your own words.
Also, what did the ENCODE project do? How did they purportedly discover all this function? What did they measure?
Last but not least, how did the ENCODE project actually define "function"?
Impress me by showing you actually understand anything about the subject, instead of just copy-pasting compiled 2nd-hand material for apologetics purposes.
Bob@RealScienceRadio wrote:Back in the 1990s, I debated Eugenie Scott (good friend of physicist Lawrence Krauss) for an hour on national TV, and I repeatedly asked her for evidence for the evolution of higher biological function (flight, circulatory system, vision system, echolocation, whatever). She eventually offered an argument: Junk DNA. (That wasn't responsive to my request, but at least it was something.) We still sell the DVD of that debate, and occasionally we play the audio on the radio, when I, the young earth talk show host, said to Eugenie that genetic science is still in its infancy, and we don't have enough knowledge to proclaim that most of the genome has no function. She disagreed. Who was correct? The leading anti-creationist scientist, or the Bible believer?
The scientist.
Bob@RealScienceRadio wrote:Even Richard Dawkins now agrees that there is function throughout the genome where the Darwinists worldwide were saying that it was non-functional junk that falsified creation and was great evidence for evolution. He's now accepting the science on this, yes, but in an expression of a zero concession policy, hasn't admitted that his side (the evolutionists) had gotten this very wrong, and instead, he pretends that this new knowledge is just what the Darwinists always had hoped for.
Nobody gives a shit, Richard Dawkins is not a biochemist or genome biologist. He's a retired Ethologist (the study of animal behavior) with a side-interest for Darwinian evolution.
Richard Dawkins is simply not an authority on molecular evolution or biochemistry.
Bob@RealScienceRadio wrote:In 2009:
Richard Dawkins wrote:It stretches even their creative ingenuity to make a convincing reason why an intelligent designer should have created a pseudogene --
a gene that does absolutely nothing and gives every appearance of being a superannuated version of a gene that used to do something -- unless he was deliberately setting out to fool us.
p. 332.
And on the next page:
Richard Dawkins wrote:Leaving pseudogenes aside, it is a remarkable fact that the greater part (95 percent in the case of humans) of the genome might as well not be there, for all the difference it makes.
p. 333.
(I'm a fundamentalist Christian pastor and I had been ahead of Dawkins on this for more than a decade.)
Actually you have not, you have been wrong all this time. Dawkins has simply done what he should, and reported what was at the time the consensus position of experts in genome evolution and biochemistry: that most of the genome was junk. Unfortunately Richard Dawkins is well known for being a bit of an "adaptationist/selectionist" and puts a very heavy emphasis on natural selection in his understanding and description of the process of evolution. This has the unfortunate side-effect that he's been a bit too quick and happy to latch on to news that adaptationist interpretations of genome evolution have been vindicated. They have not, so both Dawkins, the creationists
and the ENCODE project are all wrong.
Newsflash: The sensationalist ENCODE results about 80% functionality or more, have been largely retracted and down-scaled by the encode project authors themselves in their recent publications. Even more importantly, their claims have been utterly refuted by biochemists and population geneticists who have shown that the ENCODE project scientists failed to understand their own data and ignored half a century's work in molecular biology.
Bob@RealScienceRadio wrote:Fast-forward to 2012:
Richard Dawkins wrote:I have noticed that there are some creationists who are jumping on [the ENCODE results of apparent 90%+ genome functionality]... Quite the contrary it's exactly what a Darwinist would hope for... Whereas we thought that only a minority of the genome was doing something... [the majority] ...had previously been written off as junk.
And this is exactly why you should not take Richard Dawkins as your authority on genome evolution and biochemistry. Dawkins is known for being an extremely staunch "selectionist", who thinks that everything that evolves probably has some kind of adaptive explanation for it's existence. Many biologists have given many criticisms of his views, particularly Stephen Jay Gould.
You would do well to read Gould instead of Dawkins.
Again, also, Dawkins is not a biochemist or an expert in genome evolution. He should simply not be your go-to source for information on molecular evolution, and his words should not be taken to be accurate representations of the modern theory of evolution or even evolutionary biology in general. I'm going to go out on a limp and suggest Dawkins is probably largely unaware of what the actual case for junk DNA looks like. It is emphatically not an argument from ignorance. There are strong evidence for junk, even post-encode.
Bob@RealScienceRadio wrote:byofrcs, it's not just that they had "thought" there wasn't function.
Correct: They had SHOWN it, and the ENCODE project hype-machine neglected to consider half a century's work in population genetics and biochemistry and instead come storming out with great press releases heralding their paradigm shifts in one of the most disgusting cases of sensationalism in recent times.
Bob@RealScienceRadio wrote:Rather, they had trumpeted the genome being full of junk as powerful evidence for evolution
It still is, the genome is still mostly junk.
http://www.plosgenetics.org/article/info%3Adoi%2F10.1371%2Fjournal.pgen.1004351The Case for Junk DNAAlexander F. Palazzo , T. Ryan Gregory
Overview
With the advent of deep sequencing technologies and the ability to analyze whole genome sequences and transcriptomes, there has been a growing interest in exploring putative functions of the very large fraction of the genome that is commonly referred to as “junk DNA.” Whereas this is an issue of considerable importance in genome biology, there is an unfortunate tendency for researchers and science writers to proclaim the demise of junk DNA on a regular basis without properly addressing some of the fundamental issues that first led to the rise of the concept. In this review, we provide an overview of the major arguments that have been presented in support of the notion that a large portion of most eukaryotic genomes lacks an organism-level function. Some of these are based on observations or basic genetic principles that are decades old, whereas others stem from new knowledge regarding molecular processes such as transcription and gene regulation.
Bob@RealScienceRadio wrote:which being unguided, could be expected to leave a mess everywhere) and against a Designer (who, philosophically they claimed, would never fill His work with junk).
When he makes this bad design argument (as with pseudogenes, or the retina, or the plica semilunaris as in my debate with that Univ of Calif professor), Dawkins' risk is that there is an army of anatomists and geneticists who then turn their attention to such things. And just as has happened with about 100 claimed vestigial organs in humans, they find that this stuff is fully functional and so amazingly well designed that it sends chills up the spine of even thousands of scientists.
All wrong. The sensationalistic ENCODE results have been totally taken apart by several professional biochemists.
by 
. As the apostle John wrote in chapter 9 of his gospel:
