The Bacterial Flagellum Revisited

The accumulation of small heritable changes within populations over time.

Moderators: Calilasseia, Mazille

Re: The Bacterial Flagellum Revisited

 
 

Re: The Bacterial Flagellum Revisited

#81  Postby CharlieM » Jul 06, 2010 12:39 am

Rumraket:
So in order to understand every step in the evolution of FlglE, you'd have to understand all the other proteins in the flagellar evolution too.


Quite right, tinkering with one protein on the path affects the whole system. Its a bit like a Rubic cube only vastly more complicated. I'd say beyond the capabilities of unguided forces.

Rumraket:
The existence of protein homologues are a testable prediction of evolutionary theory


Protein homologues give us a clue that the proteins are related and were possibly derived from the same source. I have been told constantly that the path is too complex to work out. So how do we know that naturalistic evolution is the means by which the path is crossed or is even capable of negotiating that path? Must I just take it on faith? Just because we observe mutations/duplications/shufflings does not mean that they are unguided. If DNA replication is the result of an accident where did the error correcting mechanism come from? "Repair proteins appear to efficiently scan the genome for errors by jumping like fleas between DNA molecules, sliding along the strands, and perhaps pausing at suspicious spots, say researchers at the University of Pittsburgh, the University of Essex and the University of Vermont who tagged the proteins with quantum dots to watch the action unfold." - ScienceDaily Mar 14 2010.

Pierre Paul-Grassé:
In sum the mutations of bacteria and viruses are merely hereditary fluctuations around a median position; a swing to the right, a swing to the left, but no final evolutionary effect.


I wrote:
Steps of single amino acid changes along the path are not going to result in a functional protein for every step.

Rumraket:
Are you implying that the changes are going to result in a protein with loss of function, or simply that the change was neutral and therefore did not result in increased functionality? In addition, I'd like to know how you know this?


The amino acid sequence of FlgE is far longer than its homologs and so gene duplication and joining is the proposed path in its development. This involves more than a single step so I'd be surprised if anyone believed that a sequence of functional proteins in single steps occurred.

Rumraket:
So you did those supercomputermodelings? Fascinating. Please share your results.


Well Matzke proposed the path so ask him. Although the search space that naturalistic evolution needs to sample is so large that it would indeed take a supercomputer to find a way through.

I wrote:
A few evolutionary facts have been given which I presume are supposed to argue against my position. The ones I can recall are:
A monkeyflower turning into a monkeyflower, a peppered moth turning into a peppered moth and hydrogen producing bacteria turning into hydrogen producing bacteria. I have no problem with these examples of evolution.

Rumraket:
Hahaha... the micro/macro evolution canard.
And you are arguing against a bacteria without a flagellum evolving into a bacteria with a flagellum? Great. Sounds like a double standard to me.


Why? With the flagellum we have a novel structure with a new function, with the others we don't, unless you want to stretch the definition of, "function". And besides that is not what I'm arguing against.
CharlieM
 
Name: Charlie Morrison
Posts: 374

Country: UK
Scotland (ss)

Re: The Bacterial Flagellum Revisited

#82  Postby CharlieM » Jul 06, 2010 12:49 am

I wrote:
A few evolutionary facts have been given which I presume are supposed to argue against my position. The ones I can recall are:
A monkeyflower turning into a monkeyflower, a peppered moth turning into a peppered moth and hydrogen producing bacteria turning into hydrogen producing bacteria. I have no problem with these examples of evolution.

Calilasseia:
This is merely the wholly absurd regurgitation of the "I've never seen a cat give birth to a dog" piece of creationist scientific illiteracy. Which, apart from being scientifically illiterate, is a duplicitous strawman caricature of evolutionary theory erected for mendacious apologetic purposes.


Not exactly. This is the evidence I have been presented with. This to me only demonstrates the plasticity of types to adapt to their environment.

I have no problem with humanity emerging through all the forms from a single cell to what we are today, so if you presented me with solid evidence that we were once aquatic, fish-like beings, I'd say, well done, but it doesn't affect the way I envision evolution happening.
CharlieM
 
Name: Charlie Morrison
Posts: 374

Country: UK
Scotland (ss)

Re: The Bacterial Flagellum Revisited

#83  Postby Rumraket » Jul 06, 2010 6:13 am

CharlieM wrote:Quite right, tinkering with one protein on the path affects the whole system. Its a bit like a Rubic cube only vastly more complicated. I'd say beyond the capabilities of unguided forces.

You'd say that, with nothing to back it up. In other words an ex recto assertion.
Did you completely ignore the hemoglobin example provided to you? Turns out "unguided forces" work pretty well.

CharlieM wrote:Protein homologues give us a clue that the proteins are related and were possibly derived from the same source. I have been told constantly that the path is too complex to work out. So how do we know that naturalistic evolution is the means by which the path is crossed or is even capable of negotiating that path?

Because we constantly observe naturalistic evolution work in the laboratory without the aid of your god. Because no single line of evidence for evolution stands on it's own. Because it all fits together and your theological wishthinking is making you deny the obvious.

CharlieM wrote:Must I just take it on faith? Just because we observe mutations/duplications/shufflings does not mean that they are unguided.

Are you fucking kidding me? Am I supposed to believe that it makes MORE sense that an invisible, immaterial mind, "wills" the nucleotides into position?

CharlieM wrote:If DNA replication is the result of an accident where did the error correcting mechanism come from?

Is this question supposed to cast doubt on the entirety of evolutionary science? Are you honestly making a god-of-the-gaps argument?(yes, you are) Can you possibly shovel any more fallacies into one single question?
By the way, you do realize that we have successfully evolved the DNA replication mechanism in the lab, right? What I mean is that the DNA copying-fidelity mechanism is itself an evolvable entity. That means we took an enzyme that copies DNA, and then let it make a lot of copies. We then selected the enzymes that had mutated in such a way that they made less copying mistakes, had higher thermostability and a number of other positive side effects.

Directed evolution of polymerase function by compartmentalized self-replication
http://www.pnas.org/content/98/8/4552.full Full paper.
Abstract
We describe compartmentalized self-replication (CSR), a strategy for the directed evolution of enzymes, especially olymerases. CSR is based on a simple feedback loop consisting of a polymerase that replicates only its own encoding gene. Compartmentalization serves to isolate individual self-replication reactions from each other. In such a system, adaptive gains directly (and proportionally) translate into genetic amplification of the encoding gene. CSR has applications in the evolution of polymerases with novel and useful properties. By using three cycles of CSR, we obtained variants of Taq DNA polymerase with 11-fold higher thermostability than the wild-type enzyme or with a >130-fold increased resistance to the potent inhibitor heparin. Insertion of an extra stage into the CSR cycle before the polymerase reaction allows its application to enzymes other than polymerases. We show that nucleoside diphosphate kinase and Taq polymerase can form such a cooperative CSR cycle based on reciprocal catalysis, whereby nucleoside diphosphate kinase produces the substrates required for the replication of its own gene. We also find that in CSR the polymerase genes themselves evolve toward more efficient replication. Thus, polymerase genes and their encoded polypeptides cooperate to maximize postselection copy number. CSR should prove useful for the directed evolution of enzymes, particularly DNA or RNA polymerases, as well as for the design and study of in vitro self-replicating systems mimicking prebiotic evolution and viral replication.

So, was god hiding the the lab and tingling with the mutations?

CharlieM wrote:Pierre Paul-Grassé:
In sum the mutations of bacteria and viruses are merely hereditary fluctuations around a median position; a swing to the right, a swing to the left, but no final evolutionary effect.

How nice of you to quote a dead zoologist and believer in Lamarckian evolution. "The enemy of my enemy is my friend"... or what? So you quote him because he agreed with you or because you believe in Lamarckian evolution too?
In any case, his assertion is factually incorrect. As the several peer reviewed papers linked in this very thread already demonstrate beyond doubt for any rational sane person.

CharlieM wrote:The amino acid sequence of FlgE is far longer than its homologs and so gene duplication and joining is the proposed path in its development. This involves more than a single step so I'd be surprised if anyone believed that a sequence of functional proteins in single steps occurred.

You have anything to back up this claim other than a mere assertion? Got any research? It's funny how you first use the fact that noone knows the intermediates as an argument against evolution. But you aren't afraid to go speculate on it yourself when you think it can support your position. A double standard there or what?

CharlieM wrote:Well Matzke proposed the path so ask him. Although the search space that naturalistic evolution needs to sample is so large that it would indeed take a supercomputer to find a way through.

You keep talking about this "search space" that needs to be "sampled". What does that even mean? Please elaborate on it.

CharlieM wrote:Why? With the flagellum we have a novel structure with a new function, with the others we don't, unless you want to stretch the definition of, "function".

Yes but the flagellum was build by fitting existing stuff together and letting them evolve further for superior function in their new unit

CharlieM wrote:And besides that is not what I'm arguing against.

Uhh, yes it is. You have done nothing else than assert that the evolution of the flagellum was too impropable to have happened by chance. You have even asserted that it must have been planned by god.

CharlieM wrote:Not exactly. This is the evidence I have been presented with. This to me only demonstrates the plasticity of types to adapt to their environment.

Your claim was that beneficial evolutionary change was too impropable to happen by chance and therefore had to be guided. The evidence provided refutes this claim. You now move the goalposts and again just asserts out of thin air, based entirely on an emotional position brought forth by theological wish-thinking, that the demonstrated evidence doesn't result in speciation. These are the same patently false creationist arguments we have seen a million times before.

CharlieM wrote:I have no problem with humanity emerging through all the forms from a single cell to what we are today, so if you presented me with solid evidence that we were once aquatic, fish-like beings, I'd say, well done, but it doesn't affect the way I envision evolution happening.

You are of course free to interpret the evidence any way you like. But when you start trying to cast doubt on an entire field of science that works pretty fucking well without the involvement of your favorite pet magic man(who himself has not been demonstrated to exist either, which makes the claim that he is involved in tweaking evolutionary change with some grand scheme, doubly ludicrous), well people get pissed off.
User avatar
Rumraket
 
Posts: 3967
Age: 31
Male

Denmark (dk)

Re: The Bacterial Flagellum Revisited

#84  Postby DanDare » Jul 06, 2010 11:24 am

CharlieM wrote:
Rumraket:
So in order to understand every step in the evolution of FlglE, you'd have to understand all the other proteins in the flagellar evolution too.


Quite right, tinkering with one protein on the path affects the whole system. Its a bit like a Rubic cube only vastly more complicated. I'd say beyond the capabilities of unguided forces.

No no no. Working backwards from the present is what is complicated. From the past, going forward, its just a matter of what happened to work. For every change that worked or could have worked for the organisms fitness there are probably hundreds that didn't help and thousands that made things worse. Yet things come about because evolution is not planning ahead, its more like a drop of water finding its way down hill, just bumping along following the low energy gradient. Any sequence of changes that collected together over time is going to be difficult to untangle when looking at it from the present.
Atheist. Ozzie.
Image
User avatar
DanDare
RS Donator
 
Posts: 1817
Age: 50
Male

Australia (au)

Re: Calilasseia - CREATIONISTS-READ THIS

#85  Postby CharlieM » Jul 21, 2010 8:04 pm


!
MODNOTE
This post and a few of its replies were merged from this thread: "Creationists Read This". -Mr.Samsa


I wish I had more time to participate in this interesting discussion but my internet access will be very limited over the next few weeks. I will try to follow the arguments and, who knows, they may still be going strong when I return.

I still haven't heard any plausible explanation as to how the flagellar universal joint came by its remarkable ability to assemble and rotate in the way it does. I'm seriously interested in finding an answer.

Anyway I will leave this quote from Behe and try to answer any responses to this post if and when I get a chance.


Excerpt from http://www.discovery.org/a/1831

In a recent column in the Wall Street Journal (February 13, 2004, Science Journal, page B1, "Evolution Critics Come Under Fire for Flaws In 'Intelligent Design'") science writer Sharon Begley repeated some false claims about the concept of irreducible complexity (IC) that have been made by Darwinists, in particular by Kenneth Miller, a professor of biology at Brown University. After giving a serviceable description in her column of why I argue that a mousetrap is IC, Begley added the Darwinist poison pill to the concept. The key misleading assertion in the article is the following: "Moreover, the individual parts of complex structures supposedly serve no function." In other words, opponents of design want to assert that if the individual parts of a putatively IC structure can be used for anything at all other than their role in the system under consideration, then the system itself is not IC. So, for example, Kenneth Miller has seriously argued that a part of a mousetrap could be used as a paperweight, so not even a mousetrap is IC. Now, anything that has mass could be used as a paperweight. Thus by Miller's tendentious reasoning any part of any system at all has a separate "function". Presto! There is no such thing as irreducible complexity.

That's what often happens when people who are adamantly opposed to an idea publicize their own definitions of its key terms—the terms are manipulated to wage a PR battle. The evident purpose of Miller and others is to make the concept of IC so brittle that it easily crumbles. However, they are building a straw man. I never wrote that individual parts of an IC system couldn't be used for any other purpose. (That would be silly—who would ever claim that a part of a mousetrap couldn't be used as a paperweight, or a decoration, or a blunt weapon?) Quite the opposite, I clearly wrote in Darwin's Black Box that even if the individual parts had their own functions, that still does not account for the irreducible complexity of the system. In fact, it would most likely exacerbate the problem, as I stated when considering whether parts lying around a garage could be used to make a mousetrap without intelligent intervention.

In order to catch a mouse, a mousetrap needs a platform, spring, hammer, holding bar, and catch. Now, suppose you wanted to make a mousetrap. In your garage you might have a piece of wood from an old Popsicle stick (for the platform), a spring from an old wind-up clock, a piece of metal (for the hammer) in the form of a crowbar, a darning needle for the holding bar, and a bottle cap that you fancy to use as a catch. But these pieces, even though they have some vague similarity to the pieces of a working mousetrap, in fact are not matched to each other and couldn't form a functioning mousetrap without extensive modification. All the while the modification was going on, they would be unable to work as a mousetrap. The fact that they were used in other roles (as a crowbar, in a clock, etc.) does not help them to be part of a mousetrap. As a matter of fact, their previous functions make them ill-suited for virtually any new role as part of a complex system.

Darwin's Black Box, page 66.

The reason why a separate function for the individual parts does not solve the problem of IC is because IC is concerned with the function of the system:

By irreducibly complex I mean a single system which is composed of several well-matched, interacting parts that contribute to the basic function, and where the removal of any one of the parts causes the system to effectively cease functioning.

Darwin's Black Box, page 39.


The system can have its own function, different from any of the parts. Any individual function of a part does not explain the separate function of the system.
Last edited by Mr.Samsa on Jul 22, 2010 5:28 am, edited 1 time in total.
Reason: Added link to thread post was merged from.
CharlieM
 
Name: Charlie Morrison
Posts: 374

Country: UK
Scotland (ss)

Re: Calilasseia - CREATIONISTS-READ THIS

#86  Postby DaveD » Jul 21, 2010 8:15 pm

CharlieM wrote:I wish I had more time to participate in this interesting discussion but my internet access will be very limited over the next few weeks. I will try to follow the arguments and, who knows, they may still be going strong when I return.

I still haven't heard any plausible explanation as to how the flagellar universal joint came by its remarkable ability to assemble and rotate in the way it does. I'm seriously interested in finding an answer.

Anyway I will leave this quote from Behe and try to answer any responses to this post if and when I get a chance.



Image
Image
User avatar
DaveD
 
Name: Dave Davis
Posts: 1709
Age: 54
Male

Country: UK
United Kingdom (uk)

Re: Calilasseia - CREATIONISTS-READ THIS

#87  Postby CharlieM » Jul 21, 2010 8:45 pm

The ten parts that Miller has left are non-functional as a motility system. He has taken forty parts away and the motility system has lost its function. Therefore as a motility system it is non-functional. Why does Miller never acknowledge this?
CharlieM
 
Name: Charlie Morrison
Posts: 374

Country: UK
Scotland (ss)

Re: Calilasseia - CREATIONISTS-READ THIS

#88  Postby DaveD » Jul 21, 2010 8:49 pm

CharlieM wrote:The ten parts that Miller has left are non-functional as a motility system. He has taken forty parts away and the motility system has lost its function. Therefore as a motility system it is non-functional. Why does Miller never acknowledge this?

He does. Try watching the video again, this time with the sound on.
Image
Image
User avatar
DaveD
 
Name: Dave Davis
Posts: 1709
Age: 54
Male

Country: UK
United Kingdom (uk)

Re: Calilasseia - CREATIONISTS-READ THIS

#89  Postby Rumraket » Jul 21, 2010 8:54 pm

CharlieM wrote:The ten parts that Miller has left are non-functional as a motility system. He has taken forty parts away and the motility system has lost its function. Therefore as a motility system it is non-functional. Why does Miller never acknowledge this?

Whether or not he acknowledges this is irrelevant. It doesn't have to function as a motility system. But we already had this discussion so you know this. You have added nothing to this discussion that proves a problem for evolutionary theory, and the question you put forward has been answered in the bacterial flagellum thread. As lons as any intermediate step before a "finalized" flagellum is somehow funcional, and that this function can serve as a benefit to the organism, then the final system can evolve. That's it. Nothing more to say. The irreducible complexity claim is a strawman because it fails to reckognise that the intermediate steps leading to a finalized flagellum doesn't have to serve a motility function. Any beneficial funcition will do, whatever it's nature. Case closed.
User avatar
Rumraket
 
Posts: 3967
Age: 31
Male

Denmark (dk)

Re: Calilasseia - CREATIONISTS-READ THIS

#90  Postby Rumraket » Jul 21, 2010 9:16 pm

CharlieM wrote:I still haven't heard any plausible explanation as to how the flagellar universal joint came by its remarkable ability to assemble and rotate in the way it does. I'm seriously interested in finding an answer.

You know, CharlieM, I will certainly agree with you that this is an interesting question in the sense that knowing about flagellum evolution in such molecular detail will always be an opportunity to study how evolution works and learn something new and interesting.
But you are asking about a plausible explanation and when you do that, we must first determine just what you consider to be plausible?

Personally, I don't know the answer at that detail. This is an honest answer wherefrom someone is not suddenly out of nowhere justified in claiming "therefore : design".
The honest answer is : let's try and find out.
And on that note, you should propably also ask an actual evolutionary biologist... preferrably someone who studied/wrote on flagellar evolution.

CharlieM wrote:Anyway I will leave this quote from Behe and try to answer any responses to this post if and when I get a chance.

A quote that displays manifest dishonesty when he erects a strawman problem for evolutionary explanations.

Here let me spell it out as simply as I can:
THE INTERMEDIATE STEPS DO NOT HAVE TO SERVE A FUCKING MOTILITY FUNCTION.

Have I made myself clear now? Do you understand why Behe's Irreducible complexity claim is irrelevant?
User avatar
Rumraket
 
Posts: 3967
Age: 31
Male

Denmark (dk)

Re: Calilasseia - CREATIONISTS-READ THIS

#91  Postby CharlieM » Jul 21, 2010 9:47 pm

Rumraket:
That's it. Nothing more to say. The irreducible complexity claim is a strawman because it fails to reckognise that the intermediate steps leading to a finalized flagellum doesn't have to serve a motility function. Any beneficial funcition will do, whatever it's nature. Case closed.


It does recognize this. Say there are four parts serving different functions. They have to be copied, adapted, produced at the right time and place in the right quantity and interact with each other in a suitable way.

Consider the hook as one of those parts. It is made up of over one hundred protein units formed and assembled on site in a precise manner. It needs to bind accurately to itself and its neighbours and it needs to rotate in a way that is unique and cannot be achieved by unregulated forces from within the protein units.

This is what Behe is saying. You cannot just pick a few systems and throw them together. There are many other factors to consider. Finding supposed co-opted systems and homologous proteins for some of the parts is not enough. Engineers and designers use co-opted systems and standard parts for any complex machine you care to mention.

One thing is for sure, Behe's proposal that the bacterial flagellum is irreducibly complex has stimulated a fair bit of research, which can only be a good thing.

From a paper linked to by GenesForLife:

One part of this claim is that each flagellar component is used solely for the purpose of making a flagellum that, in turn, is used only for motility. Further, each flagellar protein is assumed to have appeared independently of the other component


This is another example of misunderstanding Behe's argument.
CharlieM
 
Name: Charlie Morrison
Posts: 374

Country: UK
Scotland (ss)

Re: Calilasseia - CREATIONISTS-READ THIS

#92  Postby Rumraket » Jul 21, 2010 10:23 pm

CharlieM wrote:It does recognize this. Say there are four parts serving different functions. They have to be copied, adapted, produced at the right time and place in the right quantity and interact with each other in a suitable way.

What you just wrote here does not in ANY way demonstrate that Behe's claim reckognises that intermediate steps can serve alternative functions.

CharlieM wrote:Consider the hook as one of those parts. It is made up of over one hundred protein units formed and assembled on site in a precise manner. It needs to bind accurately to itself and its neighbours and it needs to rotate in a way that is unique and cannot be achieved by unregulated forces from within the protein units.

Well duh, in some ways that description can broadly fit any protein in any organism. They all have complex, specific and detailed functions and making big changes in their structure can break or change their function, either proving deleterious for the organism or depending on the environment, be neutral or positive. Where are you going with this?

CharlieM wrote:This is what Behe is saying. You cannot just pick a few systems and throw them together.

Well, Behe is in the business of asking for planck-length, quantum mechanical-propability distributional accounts of the movements of quarks through spacetime back to the beginning of the universe before he is satisfied with the answer. And if you were to provide him with one he'd just respond by saying that it was pure speculation or impropable. Noone is impressed by this and noone is under an obligation to provide answers at that level.
It's kind of like the defense asking for an atomic-level reconstruction of the events detailed in a murder-trial in order to be "convinced" it could have happened. "How did the atoms in the bullet move and where is your evidence?" If we can't answer, it means we lose the trial? In Behe's mind the answer is yes.

CharlieM wrote:There are many other factors to consider. Finding supposed co-opted systems and homologous proteins for some of the parts is not enough.

Yes it is, it is indeed enough. It doesn't tell us exactly at the tiniest detail how it evolved, but it tells us that it evolved. The underlying assupmtion in this claim of yours is that the hypothesis for the evolution of he flagellum stands on it's own and that upon it rests the responsibility of proving evolution. This is false. Evolution is true in light of the combined weight of all the evidence in all the converging fields of scientific enquiry. What is left to explore is how it evolved.

The absense of a complete atomic-level account of flagellum evolution is not positive evidence for design.
Positive evidence for design would entail, for example, actually observing the designer at work or, the flagellum not having a genetic basis. This would make it actively impossible for it to be a hereditary unit(no genetic basis).

The simple fact is that the flagellum as we understand it now fits perfectly well with evolutionary predictions.

CharlieM wrote:One thing is for sure, Behe's proposal that the bacterial flagellum is irreducibly complex has stimulated a fair bit of research, which can only be a good thing.

From a paper linked to by GenesForLife:

One part of this claim is that each flagellar component is used solely for the purpose of making a flagellum that, in turn, is used only for motility. Further, each flagellar protein is assumed to have appeared independently of the other component



This is another example of misunderstanding Behe's argument.

CharlieM wrote:The reason why a separate function for the individual parts does not solve the problem of IC is because IC is concerned with the function of the system:

By irreducibly complex I mean a single system which is composed of several well-matched, interacting parts that contribute to the basic function, and where the removal of any one of the parts causes the system to effectively cease functioning.

Darwin's Black Box, page 39.

Not much misunderstanding going on my friend. Above here Behe is erecting EXACTLY THE IRRELEVANT CLAIM THAT THE SYSTEM WILL CEASE TO FUNCTION AS A FLAGELLUM IF YOU REMOVE CERTAIN KEY PARTS.
Behe claiming that the system is irreducibly complex as a flagellum is correct. If you remove one of the parts that make it function as a flagellum, it will cease to function as a flagellum. But this is fucking irrelevant. It's a strawman claim supposed to make it appear like the flagellum could not evolve because, "what good is half a flagellum?".
Well it turns out "half a flagellum" is entirely a virulence system or a molecular syringe, or a secretion system, etc. etc.
User avatar
Rumraket
 
Posts: 3967
Age: 31
Male

Denmark (dk)

Re: Calilasseia - CREATIONISTS-READ THIS

#93  Postby Calilasseia » Jul 22, 2010 4:21 am

And of course, Behe's claim that removing parts break the flagellum fatally is refuted by one of the scientific papers I presented in the other thread, where scientists demonstrated experimentally that removing one flagellar gene stopped flagellar biosynthesis, but removing a second gene resulted in flagellar biosynthesis restarting, with the new flagellum functioning as a motility system just as well as the original.

Game. Fucking. Over.
Image
User avatar
Calilasseia
Global Moderator
THREAD STARTER
 
Posts: 8201
Age: 50
Male

Country: England
United Kingdom (uk)

Re: Calilasseia - CREATIONISTS-READ THIS

#94  Postby Rumraket » Jul 22, 2010 7:26 am

Calilasseia wrote:And of course, Behe's claim that removing parts break the flagellum fatally is refuted by one of the scientific papers I presented in the other thread, where scientists demonstrated experimentally that removing one flagellar gene stopped flagellar biosynthesis, but removing a second gene resulted in flagellar biosynthesis restarting, with the new flagellum functioning as a motility system just as well as the original.

Game. Fucking. Over.

Well to be fair, Behe in another display of manifest dishonesty has now changed his claim to "if you remove a certain key part it will stop functioning as a flagellum".
For example, if you take away the filament the flagellum will obviously no longer function... as a flagellum. (It just so happens to be an effective virulence system now). If you remove other specific parts which would also have broke the motility function, you also get another functional unit. What is interesting here is that many of these alternative constructions have homologues (not individual proteins, but whole-system homologues) in related flagellar-absent species.
So the claim is still a strawman though, as I have explained now several times.
User avatar
Rumraket
 
Posts: 3967
Age: 31
Male

Denmark (dk)

Re: Calilasseia - CREATIONISTS-READ THIS

#95  Postby Shrunk » Jul 22, 2010 10:58 am

CharlieM wrote:The ten parts that Miller has left are non-functional as a motility system. He has taken forty parts away and the motility system has lost its function. Therefore as a motility system it is non-functional. Why does Miller never acknowledge this?


Behe has clearly changed his original definition of IC in order to accomodate the refutation it suffered by Miller and others.

LIke all all creationists, you are attempting to deflect away from the crucial issue Behe never addresses: On what evidence does he base his claim that an IC structure cannot arise thru evolution? What his argument amounts to is saying: "Some things we know to be designed are IC. Therefore, anything that is IC is designed." I hope the logical fallacy is obvious.
"The person who follows the pursuit of reason unflinchingly toward its end will be atheistic or, at best, agnostic." -William Lane Craig, Christian apologist.
User avatar
Shrunk
 
Posts: 10135
Age: 47
Male

Country: Canada
Canada (ca)

Re: The Bacterial Flagellum Revisited

#96  Postby CharlieM » Jul 22, 2010 12:32 pm

One thing I don't want to do is get into a Monty Python type argument about IC and things seem to be heading that way. That is why I would prefer to get into more detail and I'm concentrating on the flagellar hook because I see this as possibly the strongest position to argue for the IC of the flagellum. So if anyone can convince me that this is easily explained by unguided natural means, I'm ready to listen.

There is a problem with just saying it has homologs and that's it. Here is a link and an excerpts so that you can see some of the difficulties. It explains one domain of a single hook protein:

http://structbio.vanderbilt.edu/chazin/classnotes/Hybrid-methods-paper1.pdf

Domain
D1 has a rather complex, unusual fold composed of many different folding motifs: a stack of four horizontal b-hairpins one above another, alternating their orientations with crossing angles of about 1208 (Asn 79–Leu 115 and Gly 324–Gln 337, on the left side in Fig. 1); a triangular loop (Thr 116–Pro 135, on the right side in front); a four-stranded (Leu 288–Ile 314 and Asn 357–Ser 363) and a two-stranded (Val 315–Asn 321 and Ser 339–Thr 346) b-sheet (in the upper and lower half, respectively, both on the back side); two consecutive b-turns (Thr 346–Phe 352, behind the triangular loop); and a vertically extended chain (Pro 135–Ala 144, in the centre front of the upper half). This extended chain seems to be a backbone around which the other motifs assemble. A three-dimensional structural similarity search using software DALI25 resulted in no match for domain D1, confirming its unique fold. The longest dimensions of domain D1 and D2 are about 50 and 45A ° , respectively, and these two domains are connected along their long axes with an angle of about 708.

As predicted from amino acid sequences and expected from farultraviolet circular dichroic spectra, the structure of FlgE31 is very different from that of the F41 fragment of flagellin21,26, which consists of three domains with domain D1, which consists of three a-helices and a b-hairpin, domain D2, which is formed from many b-hairpins, and domain D3, which is made of a tight b-barrel. It is curious that these two molecules with completely different structures both form the tubular structures with basically the same architecture and helical symmetry.
CharlieM
 
Name: Charlie Morrison
Posts: 374

Country: UK
Scotland (ss)

Re: The Bacterial Flagellum Revisited

#97  Postby Shrunk » Jul 22, 2010 12:55 pm

CharlieM wrote:One thing I don't want to do is get into a Monty Python type argument about IC and things seem to be heading that way. That is why I would prefer to get into more detail and I'm concentrating on the flagellar hook because I see this as possibly the strongest position to argue for the IC of the flagellum. So if anyone can convince me that this is easily explained by unguided natural means, I'm ready to listen.


You're still getting it backwards. We have abundant evidence that biological structures arise and are modified by natural means such as mutations and natural selection. Whether you find that convincing is your own problem. If you are advocating the positive creationist claim that an IC structure such as the flagellum can only be produced by "design", then you need to provide the evidence for this claim, not just say, "This is what I believe. Prove me wrong."

There's a big difference between saying "IC structures can be produced by design" and "IC structures can only be produced by design."
"The person who follows the pursuit of reason unflinchingly toward its end will be atheistic or, at best, agnostic." -William Lane Craig, Christian apologist.
User avatar
Shrunk
 
Posts: 10135
Age: 47
Male

Country: Canada
Canada (ca)

Re: The Bacterial Flagellum Revisited

#98  Postby Shrunk » Jul 22, 2010 1:28 pm

Or, to put it another way, Charlie M: Please demonstrate, in precise detail down to the molecular level, the process by which the flagellar hook was "designed".
"The person who follows the pursuit of reason unflinchingly toward its end will be atheistic or, at best, agnostic." -William Lane Craig, Christian apologist.
User avatar
Shrunk
 
Posts: 10135
Age: 47
Male

Country: Canada
Canada (ca)

Re: The Bacterial Flagellum Revisited

#99  Postby Rumraket » Jul 22, 2010 1:57 pm

CharlieM wrote:One thing I don't want to do is get into a Monty Python type argument about IC and things seem to be heading that way. That is why I would prefer to get into more detail and I'm concentrating on the flagellar hook because I see this as possibly the strongest position to argue for the IC of the flagellum. So if anyone can convince me that this is easily explained by unguided natural means, I'm ready to listen.

There is a problem with just saying it has homologs and that's it. Here is a link and an excerpts so that you can see some of the difficulties. It explains one domain of a single hook protein:

http://structbio.vanderbilt.edu/chazin/classnotes/Hybrid-methods-paper1.pdf

Domain
D1 has a rather complex, unusual fold composed of many different folding motifs: a stack of four horizontal b-hairpins one above another, alternating their orientations with crossing angles of about 1208 (Asn 79–Leu 115 and Gly 324–Gln 337, on the left side in Fig. 1); a triangular loop (Thr 116–Pro 135, on the right side in front); a four-stranded (Leu 288–Ile 314 and Asn 357–Ser 363) and a two-stranded (Val 315–Asn 321 and Ser 339–Thr 346) b-sheet (in the upper and lower half, respectively, both on the back side); two consecutive b-turns (Thr 346–Phe 352, behind the triangular loop); and a vertically extended chain (Pro 135–Ala 144, in the centre front of the upper half). This extended chain seems to be a backbone around which the other motifs assemble. A three-dimensional structural similarity search using software DALI25 resulted in no match for domain D1, confirming its unique fold. The longest dimensions of domain D1 and D2 are about 50 and 45A ° , respectively, and these two domains are connected along their long axes with an angle of about 708.

As predicted from amino acid sequences and expected from farultraviolet circular dichroic spectra, the structure of FlgE31 is very different from that of the F41 fragment of flagellin21,26, which consists of three domains with domain D1, which consists of three a-helices and a b-hairpin, domain D2, which is formed from many b-hairpins, and domain D3, which is made of a tight b-barrel. It is curious that these two molecules with completely different structures both form the tubular structures with basically the same architecture and helical symmetry.

Well to be honest I don't even think the evolution of the hook poses much of a problem and a possible solution is quite simple.
What I'm going to detail here is just my personal layman's(inspired by Matzke's account and CDK007's video on youtube) take on the issue and please don't confuse my uneducated ramblings with those of possibly much more competent evolutionary biologists.

In any case, look at it this way : To begin with, what later became the hook was simply a duplicated gene of the rod protein making gene, which itself is is an evolved adhesion protein secreted by secretion apparatus. (Notice how the proteins making up the pilus, the later filament and the hook, are all homogous to each other. Additionally they are mutated duplications of adhesion proteins; a sticky substance that likes to "stick together". It propably doesn't take many mutations in such a protein to make it more structurally rigid. A perfect candidate for evolving various structural components with elasticity or similar useful traits).

This duplicated rod is straight to begin with and is slowly accumulating mutations making it bend while retaining structure. Remember, these are individual molecules sticking together entirely by intermolecular attraction forces. It is not unreasonable to postulate that this complex can undergo a very slight twist without breaking. And the proto-flagellum was propably quite slowly rotating. What is now left for evolution to do is simply to filther through mutations for improved function over generations. The pro-flagellum before a bent hook as we see it today arrived, was providing motility already, but it was poor at it. But poor is better than none at all.

A mutation happens in the proto-hook allowing it to bend slightly more, without breaking. Through generations of accumulating mutations the hook we see today becomes a reality and along this path of evolutionary history are mutations in the filament genes for increased function. Mutations in the Tol-Pal proton motion machine for increased function in its association with the rod. The rod is accumulating mutations for increased strength. None of these postulates are unreasonable in any way. The entire flagellum didn't have to assemble in one huge step. Minor adaptation on duplications yielding ever increased function over generations.

Before it was a motility flagellum, it was an adhesion protein secreting apparatus. The adhesion secretion apparatus evolved superior function and at some point, the secretion system was providing poor motility. And poor was better than none at all.
User avatar
Rumraket
 
Posts: 3967
Age: 31
Male

Denmark (dk)

Re: The Bacterial Flagellum Revisited

 
 

Re: The Bacterial Flagellum Revisited

#100  Postby CharlieM » Jul 23, 2010 12:18 am

Shrunk:
Please demonstrate, in precise detail down to the molecular level, the process by which the flagellar hook was "designed".


Obviously the sequence of nucleotides required to produce the structure of a hook proteins is contained in the genome. Here it is (FlgE):

atggccttttctcaagcggttagcggattaaacgctgccgccaccaacctcgatgttatt
ggcaacaatatcgccaactccgccacctacggctttaaatcaggcacggcctcttttgcc
gatatgtttgccggttcgaaagtgggactgggggtaaaagttgccggtatcactcaggac
tttaccgatggcacgaccaccaacaccgggcgaggtctggacgttgctatcagccagaac
ggttttttccgtctggtagacagcaacggttcggtgttctacagccgtaacggacaattt
aagctggatgaaaaccgtaacctggtgaatatgcaaggtttacagctgacgggttacccg
gcaaccggtacgccgccgactattcagcaaggggcgaatccgaccaatatttcgatcccg
aataccctgatggcagcgaaaactaccaccacggcatcgatgcagatcaacctgaattcc
agtgatccgcttcctactgttacgccattcagcgccagcaatgcggatagctataacaaa
aaaggttcggtgactgttttcgacagtcagggtaatgctcatgacatgagcgtctacttt
gtgaagaccggggataataactggcaggtctacacccaggatagcagtgatccaaacagc
attgcgaagacagcgacaacactggaatttaatgctaatggcacattagtggatggtgcg
atggcgaataatatcgcaaccggcgcaattaacggtgcagaacccgccacgtttagtctg
agcttcctcaactccatgcagcaaaataccggcgctaacaatattgtggcaaccacccag
aacggctacaaaccgggcgatctggtgagttatcaaatcaatgatgacggtacggttgtc
ggcaactattccaacgaacaaacccaactgctggggcagattgtactggcgaactttgcc
aacaacgaaggtctggcatccgaaggcgacaacgtctggtctgcgacgcaatcttctggc
gtggcgctgttggggacagccgggacgggaaactttggcaccctgaccaacggtgcgctg
gaagcgtccaacgtcgatctcagtaaagaactggtcaatatgatcgttgcccagcgtaac
tatcagtctaacgcccagaccatcaaaacccaggaccagatcctcaacacgctggttaac
ttacgctaa

This code is not the cause but just the means by which the hook is able to be formed. Likewise there are other sequences involved in the hook's formation and function. There are also epigenetic factors making a contribution. Like all the other flagellar proteins the hook protein needs to be made in precise quantities. Everything has to be finely orchestated especially in peritrichous (multi-flagellated) bacteria.

If we look at human engineering over the centuries, in the early days human involvement was hands-on throughout the process of manufacture and function of machines. The more we advance the less direct involvement there is. In other words, if we didn't know better, it wouldn't always be obvious that there was a human involved at all. But one thing we can be sure about is that all the machines around us had their origin in human minds.

Given the evidence, I believe that all the biological orchestration we see going on originates in mind, and mind far superior to anything we are capable of.

Just for interest here is the sequence for FlgG, one of the hook protein's homologs:
atgatcagttcattatggatcgccaaaacgggccttgacgcccagcaaaccaatatggac
gtcattgccaacaacctggcaaacgtcagtactaacggttttaagcgtcagcgcgcggtg
tttgaagatctgctttatcaaaccattcgccagccgggggcacagtcttccgaacaaacc
accttaccctccggattacaaatcggcacgggggtacgcccggtcgccactgaacgctta
cacagccagggaaacctgtcgcagaccaacaacagcaaagatgtcgcgattaaagggcag
ggctttttccaggtgatgttgccagatggttcatcagcctatacccgtgacggctctttc
caggtggatcagaacgggcagctggtgacggctggtggttttcaggtgcagccagcgatc
accattccggcgaatgcgttaagtatcaccatcggtcgtgatggcgtggtcagcgtaacc
caacaaggccaggcagctccggttcaggttgggcagctcaatctcaccacctttatgaat
gacaccgggctggagagcattggcgaaaacctctacaccgaaacgcaatcctctggtgca
ccgaacgaaagcacgccgggcctgaacggcgcgggactgctgtatcaagggtatgttgaa
acgtctaacgtcaacgtggcggaagaactggtcaatatgattcaggtgcaacgcgcttac
gaaatcaacagtaaagcggtgtccaccaccgatcagatgctgcaaaaactgacgcaactc
taa
CharlieM
 
Name: Charlie Morrison
Posts: 374

Country: UK
Scotland (ss)

PreviousNext

Return to Evolution & Natural Selection

Who is online

Users viewing this topic: No registered users and 1 guest