willhud9 wrote:

DavidMcC wrote:http://en.wikipedia.org/wiki/Genetic_code
Need I say more?

A word used by humans to describe something. Big deal. Eliminate the humans, what do you have? Genetics, pure and simple. It is called the genetic code because we have an understanding of the science and the process. Just like in Mathematics we have an understanding of numbers and data. But when you remove the human variable from the scenario, the genetics nor the mathematics go away, just the human attributes applied to them.

The chemicals are simply reacting in the way that they do. Forming bonds, breaking bonds, and behaving in predictable manners. It is in that predictable manner that scientists can determine what will form from what combination of nucleic acids on a strand of DNA. It is no more a literal code than a standard chemical reaction, such as the one I listed on the first page is. It may be a figurative code, dubbed so because it helps us understand the precise reaction, but it is not literally a code because a code implies a designer of the code, there was no designer of DNA, just chemistry.

Umm... That's the jamest version of it. In English, and many other languages, analogies are widely used. The word "consume" is a good example. Its most general use is as "use up", but it has specific meanings that are related to that, such as "eat", which means "consume food", so the two are analogous. Please try to do better than jamest.

DavidMcC wrote:

willhud9 wrote:

DavidMcC wrote:http://en.wikipedia.org/wiki/Genetic_code
Need I say more?

A word used by humans to describe something. Big deal. Eliminate the humans, what do you have? Genetics, pure and simple. It is called the genetic code because we have an understanding of the science and the process. Just like in Mathematics we have an understanding of numbers and data. But when you remove the human variable from the scenario, the genetics nor the mathematics go away, just the human attributes applied to them.

The chemicals are simply reacting in the way that they do. Forming bonds, breaking bonds, and behaving in predictable manners. It is in that predictable manner that scientists can determine what will form from what combination of nucleic acids on a strand of DNA. It is no more a literal code than a standard chemical reaction, such as the one I listed on the first page is. It may be a figurative code, dubbed so because it helps us understand the precise reaction, but it is not literally a code because a code implies a designer of the code, there was no designer of DNA, just chemistry.

Umm... That's the jamest version of it. In English, and many other languages, analogies are widely used. The word "consume" is a good example. Its most general use is as "use up", but it has specific meanings that are related to that, such as "eat", which means "consume food", so the two are analogous. Please try to do better than jamest.

Actually, you should try to do better, because Wil has it exactly correct.

In terms of genetic information, it is mRNA that is the code. mRNA contains triplet codons which complement tRNA vehicles which add their amino acids to the growing peptide chain. In the Wikipedia article linked by DavidMCC this is explicitly reinforced by all of the tables & figures that show Uracil instead of Thymine. mRNA is the basis for the genetic code.

Why then is DNA not a code?

DNA is like the instruction manual for writing a code. It has promoter & repressor regions, methylation modifications, introns & exons and many other elements which serve to alter precisely what mRNA is produced in response to a specific stimulus. DNA is like a book of ciphers that tells you that on 10th July 2013 turn to page 246 and use like 17 as the ciphertext for the message. The fact that DNA contains many of the same letters as the code is no more remarkable than the fact that a code book uses the same alphabet as a coded transmission.

Can we please stop with the crap about DNA somehow being a code or that it is only interpretable by intelligence?
DNA can interpret itself just fine.

Just A Theory wrote:Unless one subscribes to the idea that the ur-gene was somehow perfect and that every subsequent re-transmission of that gene is somehow flawed and/or affected by noise, then the Shannon model of information is largely inapplicable to DNA.

This, however, is just what the creationists claim. All their permitted microevolution is considered to be degeneration.

Oeditor wrote:

Just A Theory wrote:Unless one subscribes to the idea that the ur-gene was somehow perfect and that every subsequent re-transmission of that gene is somehow flawed and/or affected by noise, then the Shannon model of information is largely inapplicable to DNA.

This, however, is just what the creationists claim. All their permitted microevolution is considered to be degeneration.

And my standard response to this is to point how how this becomes an irrelevant appeal to rethorical device when said "degeneration" is capable of producing the majority of the extant biodiversity on earth.

Atheistoclast was particularly fond of the degeneration/loss of function argument. One simply erects the transition from terrestrial to aquatic mammals by highlighting how they "lost the function of walking" by "degenerating their legs" - and watch them flail around.

Oeditor wrote:

Just A Theory wrote:Unless one subscribes to the idea that the ur-gene was somehow perfect and that every subsequent re-transmission of that gene is somehow flawed and/or affected by noise, then the Shannon model of information is largely inapplicable to DNA.

This, however, is just what the creationists claim. All their permitted microevolution is considered to be degeneration.

And then the reply is to politely question if each original "kind" had all of the ur-genes for all sub-kinds and, if so, why do we find the same genes in different kinds today.

(continuing with the post of Just A Theory)
on the same chromosomes
in basically the same order
in the same orientation?

The designer could have shuffled the genes like a deck of cards, distributing them over different chromosomes, within chromosomes in different order, and with a different orientation on the strand. That is,
- if you take a chunk of DNA containing a gen, you can put it in another chromosome, and the gene functions like it did on the previous chromosome.
- the chunk could be put on the same chromosome at another location as well. And
- the chunk of DNA could be rotated over 180 degrees and inserted at its original location as well.

Bonus: Why is it that a particular gene for a particular protein differs more between kinds if according to evolution they're more distantly related. If you design stuff you don't need to do that. Plus, you don't see the DNA composition on the outside. Why go thru the trouble?

If the designer was efficient, why can't you, Mr. Creationist, accept that he wasn't he a bit more efficient and let stupid, brainless evolution do the job because the designer sure made it look that way, in every respect.

Bert
I used the word basically because due to known processes genes jump and are reoriented. But when we compare different species of non-kinds which according to the theory of evolution are related, we how similar they are in the above respects.
Of course, this leaves out the retroviral evidence which comes on top of the above.
The chromosome 2 fusion where we can still see the (degenerated) second centromeric region

hackenslash wrote:

DavidMcC wrote:

willhud9 wrote:

DavidMcC wrote:http://en.wikipedia.org/wiki/Genetic_code
Need I say more?

A word used by humans to describe something. Big deal. Eliminate the humans, what do you have? Genetics, pure and simple. It is called the genetic code because we have an understanding of the science and the process. Just like in Mathematics we have an understanding of numbers and data. But when you remove the human variable from the scenario, the genetics nor the mathematics go away, just the human attributes applied to them.

The chemicals are simply reacting in the way that they do. Forming bonds, breaking bonds, and behaving in predictable manners. It is in that predictable manner that scientists can determine what will form from what combination of nucleic acids on a strand of DNA. It is no more a literal code than a standard chemical reaction, such as the one I listed on the first page is. It may be a figurative code, dubbed so because it helps us understand the precise reaction, but it is not literally a code because a code implies a designer of the code, there was no designer of DNA, just chemistry.

Umm... That's the jamest version of it. In English, and many other languages, analogies are widely used. The word "consume" is a good example. Its most general use is as "use up", but it has specific meanings that are related to that, such as "eat", which means "consume food", so the two are analogous. Please try to do better than jamest.

Actually, you should try to do better, because Wil has it exactly correct.

Nonsense. You are joining the "I don't understand how language works" brigade. You need to remember that the kind of code that DNA isn't is not the only kind of code, as a glance at a good dictionary would show you. You should look at them once in a while, as should hack.
You must understand that this is just an extended hack-style derail to the real argument against jamest. It is he who tries to bend the English language to his ends, we should not simply turn that on its head by bending it to our own ends. It is a short-sighted approach to the problem.

bert wrote:(continuing with the post of Just A Theory)
on the same chromosomes
in basically the same order
in the same orientation?

The designer could have shuffled the genes like a deck of cards, distributing them over different chromosomes, within chromosomes in different order, and with a different orientation on the strand.

Well, they have to keep modifying their fairy-tale every time they fail to get round unavoidable facts. I imagine they reason something like: Goddidit and and worked from a template. Of course different "kinds" have similar chromosomes, to deal with all the common stuff. What the evilutionists won't admit that within each "kind" the DNA is essentially the same, dog "kind" having all the information for wolf, terrier, pekinese and...er...thylacine? That's why they get so excited about junk DNA and ENCODE: they knew all along that the differences within "kinds" were contained in "noncoding" areas where the evolutionists were refusing to look. Or something equally silly.

DavidMcC wrote:Nonsense. You are joining the "I don't understand how language works" brigade. You need to remember that the kind of code that DNA isn't is not the only kind of code, as a glance at a good dictionary would show you. You should look at them once in a while, as should hack.
You must understand that this is just an extended hack-style derail to the real argument against jamest. It is he who tries to bend the English language to his ends, we should not simply turn that on its head by bending it to our own ends. It is a short-sighted approach to the problem.

Ah, argumentum ad nauseum and argumentum ad lexicum. Let us know how that works out for you.

A metaphorical employment of the word 'code' does not make it a code. DNA is not a fucking code, it's analogous to one.

I agree Hack, and I'm pretty sure I covered that fairly comprehensively in my post here. I'm not sure why it's still an issue.

DNA isn't a code, new information can be produced by mutation & selection, the new information is only meaningful in the Kolmogorov framework, not in the Shannon sense. Intelligence is not required for any of that.

Where is the issue?

It's a puzzle, to be sure.

Just A Theory wrote:I agree Hack, and I'm pretty sure I covered that fairly comprehensively in my post here. I'm not sure why it's still an issue.

DNA isn't a code, new information can be produced by mutation & selection, the new information is only meaningful in the Kolmogorov framework, not in the Shannon sense. Intelligence is not required for any of that.

Where is the issue?

The issue is that most of the posters here have an incomplete definiton of the word "code", and you are yet another one. If you read all my posts in this thread, you will see that I point out that both jamest and hack are playing fast and loose with the definition in order to get a cheap "victory". Please look it up in a good dictionary and you will find a number of different connotations of the word - some fit the "genetic code", but others don't. What matters is that some do, so it can be called a code, but not the kind of code that jamest pretends it is. Of course, as I posted before, that has nothing to do with whether it could have evolved, although jamest pretends that it does.
As for the technicality of whether it is Kolgomorov information or Shannon, that is beside the point in this thread. I slipped up because of a confusing website that someone pointed me to, and this was exploited by those who want to paint me in religious colours, like hack and jamest (for their various motives).
NB, if you don't believe me, see the NIH paper on the genetic code that I posted a while back on this thread.

It's becoming almost funny. The genetic code is the treatment, not the fucking molecule. No playing fast and loose with anything, you're just fucking wrong.

Seriously thinking of re-naming the Dunsapy, because Dunsapy didn't miss the point by anything like the distance you have been doing in almost every thread of late, and he missed it by light years.

It tells me nothing that you got yourself confused because of a confusing website, because it was absolutely crystal-clear that you had no fucking idea of what you were talking about. The relevance of it was that YOU FUCKING BROUGHT IT UP. You were simply wrong, again, and again, and again, and unable to fucking admit it. You're just as wrong about everything else, largely because you demonstrably don't understand what's being argued here, as demonstrated by the fact that you keep erecting red herrings and irrelevancies.

Go and learn something about a topic before evacuating your bowels in this manner, and just admit, without passing blame (what, you think that it isn't your fault that you were misled by another website? More fucking fool you for holding forth in ignorance) that you got it wrong.

DavidMcC wrote:

Just A Theory wrote:I agree Hack, and I'm pretty sure I covered that fairly comprehensively in my post here. I'm not sure why it's still an issue.

DNA isn't a code, new information can be produced by mutation & selection, the new information is only meaningful in the Kolmogorov framework, not in the Shannon sense. Intelligence is not required for any of that.

Where is the issue?

The issue is that most of the posters here have an incomplete definiton of the word "code", and you are yet another one. If you read all my posts in this thread, you will see that I point out that both jamest and hack are playing fast and loose with the definition in order to get a cheap "victory". Please look it up in a good dictionary and you will find a number of different connotations of the word - some fit the "genetic code", but others don't. What matters is that some do, so it can be called a code, but not the kind of code that jamest pretends it is. Of course, as I posted before, that has nothing to do with whether it could have evolved, although jamest pretends that it does.
As for the technicality of whether it is Kolgomorov information or Shannon, that is beside the point in this thread. I slipped up because of a confusing website that someone pointed me to, and this was exploited by those who want to paint me in religious colours, like hack and jamest (for their various motives).
NB, if you don't believe me, see the NIH paper on the genetic code that I posted a while back on this thread.

All a code is is a "rule" to convert information.

0101010001101000011010010111001100100000011010010111001100100000011000010010000001100011011011110110010001100101

The above is a code, binary code to be precise, it allows computers to process information at smaller bits than other forms of information allow. It requires intelligence to gather the meaning from it. Without intelligence, the code is meaninglessly a bunch of 0's and 1's. Since computers need intelligence to be created and thus processors do not occur naturally, the point is solidified.

3' end
(START CODON -->)TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGACCGCTCATACCACGCCTCCGGG
ACCTCTCCTACAAGGACAGGAAGGGGTGGTGGTTCTGGATGAAGGGCGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCGGT
GCCGTTCTTCCACCGGCTGCGCGACTGGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGACGTG
CGCGTGTTCGAAGCCCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGGACGACCACTGGGACCGGCGGGTGGAGGGGCGGCTCA
AGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACTCGTGGCACGACTGGAGGTTTATGGCAATTCGACCTCGGAG
CCATCGTCAAGGAGGACGGTCTACCCGGAGGGTTGCCCGGGAGGAGGGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTTCAGAC
TCACCCGCCG
5' end

Is not a code. Why? Because unlike computers and other codes created by humans to process information, this one occurs whether or not intelligence is present. A code requires intelligence to be translated. DNA, which the above is a sampling of an alpha subunit of hemoglobin's dna sequence which mrna will transcribe, does not. It is simply chemicals reacting to each other. Unlike a computer which does what it is programmed to do. DNA and RNA are not doing anything they've been programmed to do, but are just doing what they are doing because they are chemicals and follow the laws of chemistry.

Will,

Exactly, but none of that matters when you don't give a fuck about reality.

RS

DavidMcC wrote:
The issue is that most of the posters here have an incomplete definiton of the word "code", and you are yet another one.

Right. So the issue here is that I just don't understand the definition. Glad we cleared that up.

If you read all my posts in this thread,

I've read all of your posts in this thread. Like this where you maintain that nucleotides are not symbols. Or the very next one where you introduce the concept of digital information, in ALL CAPS no less, but completely fail to define what that actually is or why it is important. We can even go a few more down to this post where you decide that nucleotides are symbols after all but can't see the relevance of some of the basic concepts in information theory to the subject of genetics.

you will see that I point out that both jamest and hack are playing fast and loose with the definition in order to get a cheap "victory".

Actually, I can't see where you do that at all. What I can see is you getting repeatedly educated on the core concepts of information theory, a subject which you do not seem to have much experience with, and you arguing from a position of ignorance in a vain attempt to deny that you made an error or were mistaken.

Please look it up in a good dictionary and you will find a number of different connotations of the word - some fit the "genetic code", but others don't. What matters is that some do, so it can be called a code, but not the kind of code that jamest pretends it is. Of course, as I posted before, that has nothing to do with whether it could have evolved, although jamest pretends that it does.

Well, let's go look at a good dictionary and see what it says:

1. a system for communication by telegraph, heliograph, etc., in which long and short sounds, light flashes, etc., are used to symbolize the content of a message: Morse code.
2.
a system used for brevity or secrecy of communication, in which arbitrarily chosen words, letters, or symbols are assigned definite meanings.
3.
any set of standards set forth and enforced by a local government agency for the protection of public safety, health, etc., as in the structural safety of buildings (building code) health requirements for plumbing, ventilation, etc. (sanitary or health code) and the specifications for fire escapes or exits (fire code)
4.
a systematically arranged collection or compendium of laws, rules, or regulations.
5.
any authoritative, general, systematic, and written statement of the legal rules and principles applicable in a given legal order to one or more broad areas of life.

None of those seem to fit DNA, but there is another entry down below:

See also genetic code a system of letters or symbols, and rules for their association by means of which information can be represented or communicated for reasons of secrecy, brevity, etc: binary code ; Morse code

Aha! But there is a link under the words genetic code. I wonder where it leads?

the biochemical instructions that translate the genetic information present as a linear sequence of nucleotide triplets in messenger RNA into the correct linear sequence of amino acids for the synthesis of a particular peptide chain or protein.

Now, you obviously didn't retain much information from my earlier post where I mentioned:

I wrote:In terms of genetic information, it is mRNA that is the code. mRNA contains triplet codons which complement tRNA vehicles which add their amino acids to the growing peptide chain. In the Wikipedia article linked by DavidMCC this is explicitly reinforced by all of the tables & figures that show Uracil instead of Thymine. mRNA is the basis for the genetic code.

See how my explanation lines up with the definitions which you requested that I go look up? See how your assertions do not?

As for the technicality of whether it is Kolgomorov information or Shannon, that is beside the point in this thread.

Actually, it's precisely the point. The entirety of the creationist argument revolves around conflation of two different information theories to somehow make it seem as if no new information can be produced by Darwinian methods. Understanding this is critical to refuting the creationist talking point.

I slipped up because of a confusing website that someone pointed me to, and this was exploited by those who want to paint me in religious colours, like hack and jamest (for their various motives).

Actually, you slipped up because you have a very incomplete understanding of information theory. There is absolutely no shame in that except when you insist on arguing with people who DO have a good understanding of the relevant concepts.

NB, if you don't believe me, see the NIH paper on the genetic code that I posted a while back on this thread.

I can post links to papers that I don't fully understand, it doesn't prove anything except that I can use Google.

Just A Theory wrote:

DavidMcC wrote:
The issue is that most of the posters here have an incomplete definiton of the word "code", and you are yet another one.

Right. So the issue here is that I just don't understand the definition. Glad we cleared that up.

If you read all my posts in this thread,

I've read all of your posts in this thread. Like this where you maintain that nucleotides are not symbols. Or the very next one where you introduce the concept of digital information, in ALL CAPS no less, but completely fail to define what that actually is or why it is important. We can even go a few more down to this post where you decide that nucleotides are symbols after all but can't see the relevance of some of the basic concepts in information theory to the subject of genetics.

you will see that I point out that both jamest and hack are playing fast and loose with the definition in order to get a cheap "victory".

Actually, I can't see where you do that at all. What I can see is you getting repeatedly educated on the core concepts of information theory, a subject which you do not seem to have much experience with, and you arguing from a position of ignorance in a vain attempt to deny that you made an error or were mistaken.

Please look it up in a good dictionary and you will find a number of different connotations of the word - some fit the "genetic code", but others don't. What matters is that some do, so it can be called a code, but not the kind of code that jamest pretends it is. Of course, as I posted before, that has nothing to do with whether it could have evolved, although jamest pretends that it does.

Well, let's go look at a good dictionary and see what it says:

1. a system for communication by telegraph, heliograph, etc., in which long and short sounds, light flashes, etc., are used to symbolize the content of a message: Morse code.
2.
a system used for brevity or secrecy of communication, in which arbitrarily chosen words, letters, or symbols are assigned definite meanings.
3.
any set of standards set forth and enforced by a local government agency for the protection of public safety, health, etc., as in the structural safety of buildings (building code) health requirements for plumbing, ventilation, etc. (sanitary or health code) and the specifications for fire escapes or exits (fire code)
4.
a systematically arranged collection or compendium of laws, rules, or regulations.
5.
any authoritative, general, systematic, and written statement of the legal rules and principles applicable in a given legal order to one or more broad areas of life.

None of those seem to fit DNA, but there is another entry down below:

See also genetic code a system of letters or symbols, and rules for their association by means of which information can be represented or communicated for reasons of secrecy, brevity, etc: binary code ; Morse code

Aha! But there is a link under the words genetic code. I wonder where it leads?

the biochemical instructions that translate the genetic information present as a linear sequence of nucleotide triplets in messenger RNA into the correct linear sequence of amino acids for the synthesis of a particular peptide chain or protein.

Now, you obviously didn't retain much information from my earlier post where I mentioned:

I wrote:In terms of genetic information, it is mRNA that is the code. mRNA contains triplet codons which complement tRNA vehicles which add their amino acids to the growing peptide chain. In the Wikipedia article linked by DavidMCC this is explicitly reinforced by all of the tables & figures that show Uracil instead of Thymine. mRNA is the basis for the genetic code.

See how my explanation lines up with the definitions which you requested that I go look up? See how your assertions do not?

As for the technicality of whether it is Kolgomorov information or Shannon, that is beside the point in this thread.

Actually, it's precisely the point. The entirety of the creationist argument revolves around conflation of two different information theories to somehow make it seem as if no new information can be produced by Darwinian methods. Understanding this is critical to refuting the creationist talking point.

I slipped up because of a confusing website that someone pointed me to, and this was exploited by those who want to paint me in religious colours, like hack and jamest (for their various motives).

Actually, you slipped up because you have a very incomplete understanding of information theory. There is absolutely no shame in that except when you insist on arguing with people who DO have a good understanding of the relevant concepts.

NB, if you don't believe me, see the NIH paper on the genetic code that I posted a while back on this thread.

I can post links to papers that I don't fully understand, it doesn't prove anything except that I can use Google.

Ha! It is you who is posting on a subject you do not fully understand. See GrahamH, he'll put you right, even if my attempts are crapped on by people who should know better.. The main point is to realise not only that "the genetic code" could have evolved by natural selection, but also that jamest is trying to use the argumentum ad lexicum trick to "prove" he is right, when he patently is not right. What do you not understand about that???